Basic Information

Symbol
CSH1
RNA class
mRNA
Alias
Chorionic Somatomammotropin Hormone 1 PL Placental Lactogen Choriomammotropin HCS-A CSMT CSA Chorionic Somatomammotropin A FLJ75407 Chorionic Somatomammotropin Hormone 2 Chorionic Somatomammotropin-1 Growth Hormone B3 Lactogen HCS-1 CS-1 GHB3
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_001317.6
Sequence length
821.0 nt
GC content
0.5652

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-257.70 kcal/mol
Thermodynamic ensemble
Free energy: -274.49 kcal/mol
Frequency: 0.0000
Diversity: 171.46
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((...(((((((((.((((((........(((((...((((((((((((.....(((.((((((((.((((..(......)..)))).....(((....)))...(((((((......)))....))))(((((((((((....................(((((...((.((.....)).)).)))))....))).)))))))).)))))))).)))......(((((((((.(((.......(((....))).((((((...((((......))))............)))))).))))))))))))..........((((((...)))))).......................)))))).))))))...)))))..((((...)))).(((..(((((((.......((((((((((((....((((......((.(((((...)))))..))...))))..)))......(((....)))))).))))))))).))))..)))....))))))..)))....((((....))))...(((((((..(.(((............((.((((((...)))))).)).......))).)..))))))).......((((((((.(((.(((..((((((.....(.(((...))).)....)))))).)))))).))))).))).....(((.(((((...(((((.((((((.(((.(((..(((..(((.(........)))))))..)))..))))))..))).))))).....))))).))))))))))))))...................
Thermodynamic Ensemble Prediction
(((((...(((((((((.(((((({.......(((((...((((((((((((....,(((.((((((((,((((..,..((..,..},.)..))}}|{....)}}.,,{{{{(((......)))....)))|(((((((((((....................||{{{...|{.,..,,..,|.},.})))}....))).)))))))),)))))))).))}......(((((((({,(((.......{{{...,))}.{{({({...{{,,..,,,.,,},....{{{{....,,)))).))))))))))))..........((((({...}))))).........,{,.......,,,.)))))).))))))...)))))..{({{...)}}|,(({,.(((((((,.,..||||({(.(((((,,,({((((,.....{,.(((({...)))))..))...))}),,)},,,..,||||}..}))}}),..}})..))).)))}..))).,.}))))))..)))..,.((((....}))}..,(((((((..{.({{,{,,,.......((.((((((...)))))).)).......})}.}..))))))},|.....{({(((((.(((.(((..((((((.....(.(((...))).)....)))))).)))))).))))).))).}},.(((.(((((.,,(((((.((((((.(((.(((..(((..(((.(........,))))))..)))..)))))),.))}.)))))...,,))))).))))))))))))))...................

Transcripts

ID Sequence Length GC content
UAGGAUCCCAAGGCCCAACUCCCCGAACCACUCAGGGUCCUGUGGACAG… 821 nt 0.5652
Summary

The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones and plays an important role in growth control. The gene is located at the growth hormone locus on chromosome 17 along with four other related genes in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. Although the five genes share a remarkably high degree of sequence identity, they are expressed selectively in different tissues. Alternative splicing generates additional isoforms of each of the five growth hormones, leading to further diversity and potential for specialization. This particular family member is expressed mainly in the placenta and utilizes multiple transcription initiation sites. Expression of the identical mature proteins for chorionic somatomammotropin hormones 1 and 2 is upregulated during development, although the ratio of 1 to 2 increases by term. Mutations in this gene result in placental lactogen deficiency and Silver-Russell syndrome. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans evaluating placental mRNA markers for forensic pregnancy diagnostics from dried blood stains found that the CSH1 showed no pregnancy-specific expression pattern in whole blood analysis [Gauvin et al. DOI:10.1007/S00414-008-0315-6].