| ID | Sequence | Length | GC content |
|---|---|---|---|
| AACUGCGGCGUCAUCCCGGCUAUAAGCGCACGGCCUCGGCGACCCUCUC… | 2055 nt | 0.6360 |
This gene encodes a member of the A1 family of peptidases. The encoded preproprotein is proteolytically processed to generate multiple protein products. These products include the cathepsin D light and heavy chains, which heterodimerize to form the mature enzyme. This enzyme exhibits pepsin-like activity and plays a role in protein turnover and in the proteolytic activation of hormones and growth factors. Mutations in this gene play a causal role in neuronal ceroid lipofuscinosis-10 and may be involved in the pathogenesis of several other diseases, including breast cancer and possibly Alzheimer's disease. [provided by RefSeq, Nov 2015]
A study in mice and humans demonstrated that the CTSD is consistently upregulated in peripheral blood mononuclear cells of patients who develop heart failure after acute myocardial infarction and in recruited monocytes/macrophages from AMI mice, showing excellent diagnostic performance with an area under the ROC curve of 0.889 [Chen et al. DOI:10.1186/s12920-021-00890-6]. In human studies, the CTSD mRNA was significantly upregulated in salivary extracellular vesicles from both emergency department and concussion clinic patients following mild traumatic brain injury compared to healthy controls [Cheng et al. DOI:10.1002/jcp.28139]. A study in mice demonstrated that the CTSD can be detected as early as 0-5 minutes after injury in skin incisions, ligature marks, and burned skin areas using immunohistochemical methods [Giuliana Pennisi et al. DOI:10.1007/s12024-022-00551-9]. However, its utility as a vitality marker for wound age estimation in forensic investigations is debated, as no single marker has been definitively validated as a gold standard based on efficacy, specificity, and reliability.