Basic Information

Symbol
CTSD
RNA class
mRNA
Alias
Cathepsin D CLN10 CPSD Ceroid-Lipofuscinosis, Neuronal 10 EC 3.4.23.5 Epididymis Secretory Sperm Binding Protein Li 130P Cathepsin D (Lysosomal Aspartyl Protease) Lysosomal Aspartyl Peptidase Lysosomal Aspartyl Protease HEL-S-130P EC 3.4.23
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Sudden death from CNS diseases Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_001909.5
Sequence length
2055.0 nt
GC content
0.6360

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-895.70 kcal/mol
Thermodynamic ensemble
Free energy: -930.92 kcal/mol
Frequency: 0.0000
Diversity: 496.05
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......(((.(((.((((((.....((((.((((((((((((((.((((......(((....)))((...((((((((...(((((((((.((((((((((.(((....))).....((((((((((.((.((((((.(((...(.(((((((((....(((.((.((((......)))).)).)))))))).)))).))))))))))(((((.(((((.....(((...((((((((((((((((((((.(((...(((((((((((....((((.((((......(((.(((....))))))...(((((((((((((((.(((.......))).))))....))))).))))))....)))).))))......))))).))))))....))).))....((((((((.(((((((((((.....))...))))....)))))...)))))))).............)))))))..((((((...(((...))).)))))).(((((((((((((((.((..(((....)))..))))))))).....(.((.((((....((....))....)))).)).).....))))))))........((((((((((....((..(((((.((.....((((((.(((...))))))))).))))))))).)))))).))))(((((((..(((.......((((((..(((...........)))))))))...(((((((((..((((....))))...))))))..)))...)))..)))))))..)))))))))))...)))(((.((((((((((((.(((..((...))..)))...)))))...........)))))))))).)))))..)))))(((((....)))))))))))))))))(((.((((((.(((.((.(...(((((.(((((...(((...))).))))).).)))).).)).))).)))))).)))..))))...)))))).)))))))))....)))))..))).)).....(((((.((........))))))).)))).)))(((((((((((((((..(((...))).)).))).(((....))).......((((.....))))..((((.(((((((((.((.((((((((((((..((.(((((((.(((((..((((..(((........)))))))..))))).)))........)))))).)))))).))))))))....)))))....)))).)))).......))))))))))..)))))))))))((((((............(((((....))))).......(((((((((((((.(.(((.(((((.(((..(((((((((.((......(((((.(((...(((((.(((...(((((......)))))(((((((...)))).))).......)))..)).)))..)))..)))))......))...))))).))))....))).))))))))...).)))))).)))))))))))))(((((.((((.(((((.((((.((......)))))).)))))......(((...(((((((...))))))).)))......((((((((((........)))))))))).....)))).))))).))))..)))))).))))))((((((((((.(((((((((((((((((((((((....((........)).....))))))))....((((((((.(....))))))))).((..((((((.((.(((((...(((((((((..(.(.((......)).).)..)))))).)))))))).)).))).)))..))))))......(((((((((........)))))))))..(((((((((...))))))))))))).......)))))))..)))))).))))...(((((((((.((((((.((((..((((((((.((((.(((((((.......))))))).))).)...)))))).)).))))........))))))..)))))))))....
Thermodynamic Ensemble Prediction
....{{((({((,.,,,((({{...(((,.((((((((((((((.((((.....{(((....)))|,,..({.(((((...(((((((((.(((((({{((.(((....))).,,..((((((((((.{,.((((((.(((..,(,((({(((({...,(((.((.((({.,...,}))).)).)))))))).)))).})))))))))(((((.(((((..,,.{{{...(((((((((((.(((({{,..{{|...(((((((((.((((((.((((((...,..{.....|{.,..,,)))))).)))))}{,..(((((.(((......,))).))))),,...((((....))))..))))))))).....|,{((((({(,,,..{{.,{{{{,...((((((((.(((((((((({.....,}.,.})))....)))))...)))))))).....{{({{({..((((.{.{{{{{(((.{{{....(((((((((.,{((,....))}).)))))))))|||,{{{|||}}||||||{{({{{{,{,({,,,..{,||,,||}|,..|||||||}.}..,}||||{{,(|,{{.....((((((((((....((..(((((.{{.....{(((((.(((...))))))))).}}))))))).)))))).))))})},))))})})}...))).),)))).,}))))},}.....,.))))),.},.(({((((((..((({....})))...))))))..))).)))))))).}.)))).))))))))))),,,}}}{||,((((((((((((.{{{..{{...||..|}}...))))}.,},,}},..})))))))))}.)))))..)))))(((((....)))))})))))))))))(((.((((((.(((.{(,{...((((({(((((...(({...})).)))))}).)))))..)),))).)))))).)))..)))),,,)))))).)))))))))....))))).}))}.}},....(((((.((........))))))).)))).))}((((((((((...(({{,(({..{|,.|(((((.(((,..,(((...))))))))))),.,,....{,{|,|||,|||||}||.(((((((((((({{{,.{((,(((.(((((..((((..(((.......,))}))))..))))).))).}}.....))),}..)))))).)))))),,....,|||,|{,,,,,},,))).......)))))))))).,))))))))))),,|||,..}}}},.....||||,}}}}}}|||{{{....(((((((((((((.(.(((.(((((.(((..(((((((((.((......(((((.(({...{{,.....{..,(((((......)))))|{{{{({..,}})),||}...,|,,,}.}}}),)}}..}))..)))))......}}.,,))))),,)))....))).))))))))...).)))))).)))))))||||||(({((.{{({.(((((.((((.((......)))))).))))).,....(((...(((((((...))))))).)))......((((((((((........)))))))))),.,,,)})),}}}||,||}}..))))))})),))|((.(((((((.((((((((((({(,,((((((((....((.......,||.....})))))||,,,,((((((({.(....})))))))).,,..((((((.((.(((({..,(((((((((..,.{.((......)).,.,,.)))))).)))))))).)).))).)))})))))),,.....(((((((((........)))))))))..(((((((((...)))))))))})},.......)))))))..))))))).)))...(((((((((.((((((,((((..{{((((((.{(((.(((((((.......))))))).))).)...)))))).}}.)))}.....,..))))))..)))))))))....

Transcripts

ID Sequence Length GC content
AACUGCGGCGUCAUCCCGGCUAUAAGCGCACGGCCUCGGCGACCCUCUC… 2055 nt 0.6360
Summary

This gene encodes a member of the A1 family of peptidases. The encoded preproprotein is proteolytically processed to generate multiple protein products. These products include the cathepsin D light and heavy chains, which heterodimerize to form the mature enzyme. This enzyme exhibits pepsin-like activity and plays a role in protein turnover and in the proteolytic activation of hormones and growth factors. Mutations in this gene play a causal role in neuronal ceroid lipofuscinosis-10 and may be involved in the pathogenesis of several other diseases, including breast cancer and possibly Alzheimer's disease. [provided by RefSeq, Nov 2015]

Forensic Context

A study in mice and humans demonstrated that the CTSD is consistently upregulated in peripheral blood mononuclear cells of patients who develop heart failure after acute myocardial infarction and in recruited monocytes/macrophages from AMI mice, showing excellent diagnostic performance with an area under the ROC curve of 0.889 [Chen et al. DOI:10.1186/s12920-021-00890-6]. In human studies, the CTSD mRNA was significantly upregulated in salivary extracellular vesicles from both emergency department and concussion clinic patients following mild traumatic brain injury compared to healthy controls [Cheng et al. DOI:10.1002/jcp.28139]. A study in mice demonstrated that the CTSD can be detected as early as 0-5 minutes after injury in skin incisions, ligature marks, and burned skin areas using immunohistochemical methods [Giuliana Pennisi et al. DOI:10.1007/s12024-022-00551-9]. However, its utility as a vitality marker for wound age estimation in forensic investigations is debated, as no single marker has been definitively validated as a gold standard based on efficacy, specificity, and reliability.