| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAGGGGACAGCACUGAGCUCUGCCGCCUGGCUCUAGCCGCCUGCCUGGC… | 3164 nt | 0.6030 | |
| AAGGGGACAGCACUGAGCUCUGCCGCCUGGCUCUAGCCGCCUGCCUGGC… | 3285 nt | 0.5988 |
This gene belongs to the CX3C subgroup of chemokines, characterized by the number of amino acids located between the conserved cysteine residues. This is the only member of the CX3C subgroup, which contains three amino acids between cysteine residues, resulting in a Cys-X-X-X-Cys configuration. The encoded protein contains an extended mucin-like stalk with a chemokine domain on top, and exists in both a membrane-anchored form where it acts as a binding molecule, or, in soluble form, as a chemotactic cytokine. The mature form of this protein can be cleaved at the cell surface, yielding different soluble forms that can interact with the G-protein coupled receptor, C-X3-C motif chemokine receptor 1 gene product. This gene plays a role in a wide range of diseases, including cancer, vasculitis, neuropathies, atherosclerosis, inflammatory diseases, and in human immunodeficiency virus infections. [provided by RefSeq, Sep 2017] CIViC Summary for CX3CL1 Gene
A study in rats demonstrated that the CX3CL1 was significantly decreased in brain tissue in an Alzheimer's disease-like model and was significantly restored by treatment with astaxanthin-loaded invasomes, correlating with improved memory and reduced pathology [Kandeil et al. DOI: 10.1007/S12035-025-05241-5]. In human traumatic brain injury patients, soluble CX3CL1 concentrations were significantly elevated in cerebrospinal fluid over 14 days post-injury compared to controls, with levels strongly correlating with blood-brain barrier dysfunction [Rancan et al. DOI: 10.01.WCB.0000133470.91843.72]. A study in rats demonstrated that blast wave exposure induces time- and intensity-dependent changes in the CX3CL1 mRNA expression, with a decrease at 2 hours after a 5 psi blast and a larger, longer duration down-regulation after 10–11 psi exposure, while a 14–15 psi exposure caused up-regulation at 2 and 72 hours [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001]. In a separate study of UVB-induced inflammation in human and rat skin, the CX3CL1 was not identified among the significantly dysregulated transcripts [Dawes et al. DOI:10.1371/journal.pone.0093338].