Basic Information

Symbol
CX3CL1
RNA class
mRNA
Alias
C-X3-C Motif Chemokine Ligand 1 Fractalkine Neurotactin C3Xkine ABCD-3 CXC3C SCYD1 CXC3 NTN Small Inducible Cytokine Subfamily D (Cys-X3-Cys), Member 1 (Fractalkine, Neurotactin) Chemokine (C-X3-C Motif) Ligand 1 CX3C Membrane-Anchored Chemokine Small-Inducible Cytokine D1 C-X3-C Motif Chemokine 1 NTT Small Inducible Cytokine Subfamily D (Cys-X3-Cys), Member-1 FKN
Location (GRCh38)
Forensic tag(s)
Forensic psychiatry evaluation Mechanical injury analysis Other applications

MANE select

Transcript ID
NM_002996.6
Sequence length
3285.0 nt
GC content
0.5988

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1383.80 kcal/mol
Thermodynamic ensemble
Free energy: -1439.49 kcal/mol
Frequency: 0.0000
Diversity: 859.71
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((((((..((((((((((((.((((....(((((.(((((((.(((....)))....((((.(((...((((((((((............))))))))))...((..((((........))))..))(((((..(((((......)))))..)))))((((.(........).)))))))..))))(((((...(((((..........))))).)))))..............)))))))....)))))................((((((((.((..((((.((((..(((((((......((((((((....((((..(((.((......)).))).)))).((((((((((((.............(((..(((((((((........)))..))))))..))).....(((((((((....))))))..)))....(((((((((..(((...)))..)))))))))....))))))))))))....).)))))))(((....)))))))))).))))((((((....))))))...((((.((((((....((((((((...)))))))).((((..((((.(((...))))).))..)))).)))))).))))((((.....)))).)))).)).)))))))).....)))).)))))))))))))))).((((((..(((((((((((...))))))...(((((((..(..((.((((((.(((((((..((((((.((..((((((((.....((.((((.((((((((((((((((....)))).)))).((((((((..(((.(((((((((((((.((...((((((((((....)))))).(((((((((((.((((((((.(((((.((((((((..((...((((((((((((((((((..((((((.............(((((((.(((....))))))))))((((((((((..(((((.(((...))).)))))..))))...)))).)).......))))))..))).)).)))))).((.(((((((((.....((....)).....))))))))).))(((((((..(((((((.((.(((((((..((....)).))))))).)).)))))))..))))))).(((.....((((((.(((.(((.((((((((.((....)).)))))..((..((((((((...))))))))..))))).)))))).)))))).....)))..))))))).))))))))).....).))))).......((((((((((...))))))))))..)))))))).)).))))).................(((((((((((((((((((((((...((((((((.((((((((.....((((.((...((((...))))....(((.((((...))))))).)))))).....)).)))))).)).(((.(((((((((((((..................................((((.((((..((((((((...))))))))))))...))))...((((((......))))))....)))..)))))))))).)))........(((((.....))))))))))))))))).......))).))))))))))))))...........))))..)))).)).)))).)))))))))(((((((..(((.........)))...)))))))...........(((((((((((......(((((((.(((((..(((((((..(((((........)))))..))))))).)))))..((((((..(((((.(((.((((((((((...((((.(((.((((((((.(((((.(((..((((((((....((((((((((((......(((.(((..((((.((..((.(((.(..((((............))))).)))))..)).)))).)))..))).....))))))))))))..)).)))))))))))))).......((((......)))).........(((((...)))))......))))))))))).))))))))))).((..(((((((((........)))).....)))))..))...((((((((((.(((((.....((((..((.(((...))).))..))))))))).)))))).((....))....((((....(((.(((.(..((((..(((...)))))))..).))).))).....))))(((((((.((((((.((.........)))))))).)))))))..(((....)))..((((((.((((((.((((.(....).))))...))))))..))))))))))...)))))).)))))))))))(((((((...)))))))(((((.((((......((((..((......))..))))(((((((((((.......(((.....)))...........(((........)))................((((((((..(((((((((.....(((((..((((........))))))))))))))))))...))...))))))......)))))))))))))))...)))))((((((((.((.(.(((.....)))).)).))))))))...)))).))).((((........))))))))))))))))))..))))))))((((((((((((((...((.(((((.(((.........))).))))))).)))))............)))))))))......))))))))...((((((.(((..((((....)))).)))...))))))..(((.(........))))(((((.........))))).......((((((((...(((((((((((..............)))))))).)))))))))))...)))).))...))))))))....)).)))))).(((((......))))).))))))).).)))))))..)..)))))))..((((((((((...))))))))))..)))))))))))....((......))((((((((.(((((...))))).))....)))))).....))))))..((((.(((((((((((((.....((((..((.(((((((..((.((((..(((...(((((....))))).((((((.(((....))).))))))...))).))))))...)))))))))..))))......)))))))........)))))))).)).
Thermodynamic Ensemble Prediction
..(((({.{(((..((((((((((((.((((....(((((.(((((((,{(,....)))...,{{((.{,,...((((((((((...,........))))))))))...,{..((((........))))..||,(((({{,,,,,...}}})))}}..}}|||(({,.,...,|,.,},}}.,))),.))}}|{(((...(((((.,,....,,.))))).)))}}...........}..)))))))....)))))......{,,.......((((((((.((..((((.((((.((((((((...,,.(((((((,....((((..(((.((......)).))).)))).((((((((((((.......,.....(((..(((((((((........)))..})))))..))).,,|.(((((((((....))))))..})).,..(((((((((..{((...))}..)))))))))....))))))))))))....}.))))))),{{...}),.))))))),))))((((((....))))))...((((.((((((....((((((((...)))))))).((((.,({{{.(((...))))).))..)))).)))))).))))((((|...,)))).)))).)).)))))))).}},.)))).))))))))))))))))))))((((({{(((.((((((....,({{{((((,..,,.}}}}.{.((((((((({{(((..((((((.((((,(.(((((.,,,.((((.(({(,{,,,..,,|,||||.}}}),,,.},)).})))).|.)}).).)))))).|||,{{{.,,,{({{{((((((....}}||||.{{||(({{{{{.{{{|||||,{||||.{(((((((..((...((((((((((((((((((..((((((..{((,....,))|((((((.(((....)))))))))|({((((((((..(((((.(((...))).)))))..))))...)))).)).......))))))..))).)).))))))}((.(((((((((.....((....,).....))))))))).))(((((((..(((((((.((.(((((({..((....)).})))))),)).)))))))..))))))),(((,....((((((.(({,(((.((((((((.((....)).)))))..((..((((((((...))))))))..))))).)))))).)))))).....,)),,))))))).))))))))).....),)))))},,....{(((((((((...))))))))))..,)))}}}}.}}.))))}...((((((((......((((((((((((({(((((((((..{(((((((((((((,((..(((((.(({((...((({...))))....,))}..,,,,.))))))).)))))..)).,}))))},{.(((((,(.(((((((((((({.........,,,,,..}},.....,,.,.}))))).).))))).}((((((((...))))))))..)))))))))...{((((,......})))}}....,..(((......)))....,{(((....((((((.................))))))....)))}))))))))))))))..((((((((((,{{{,({,{,,,,,.,{||,|||}|{,|{||,(((((((((..((((.,{{{(((...))))}{((((((((...{(((({(({{{{..(((((((.(((((..(((((((..(((((........)))))..))))))).))))).,,{{{{,,,,,...}))),),)))))))....,}}..}))...,)})))..))))))))}.))))..))))))))}.,{({((((((.{{.({..{{{{{|||{{{{|.{(((((((({{{,{{{{.,{{{{.{{.{{{(({............(((((((((({{{(((...((((.((..(((....)))..)))))),......{(({......}}||,....,,...((((((...((.((((((((({..{(((....,,{({({{,.((..(((((((((.,......)))),....,))))..)).,,{||,((((((.(((((.....((((..((.(({...})).))..))))))))).)))))).{{....}}....((((,,,,(((.({{.,..{|{{..(((...||||}||{,..|||.,,,.}}},))),||||{{{.((((((.((.........)})))))).))))}|}|.({(....))).{((((((.((((((.((((.{....}.))))...))))))..)))))))|||.},}.,||},,||{{|{{{(((((((((...))))))))|{{{.{{{{......((((..{{......)}|,))))({{{{{{{||{...,,..,,......|||.......,..,||||,,...,,}}|.,,,,,,,{{..,,..((((((...,{((((((((,...((((({..((((........))))}))))))))))))).|||}...))))}|...,,,}}}})))))))}))),,,}))}{||||||||,{{.{.({(.....)))),)).)})))}}}}}})))))))}.{|||,,..,,..)})})))))))))))))))))))))...(((((((((((,,,...(({(({({.,|,||........)),,,}}},,.}}},.,.,,,},}..))))))))))){((((.,{,((((({...}))))).)..))))}....))))))))))))))),)))))).))..))}},}}}}||{{{|,.|,..,,)))}),.,,.,}|(((((((...(((((((((((..............)))))))).))))))))))}.,,)))}.,,,}}))))))))},}})),}})),),|,,||,.}},,)))))}))),)))))))))).||,......}))....((((((((({...}))))))))).....))))))))....,|}},)))))))))|,,({(({{,...)))),}))})))))).))))))))).,,,.,{{((.(((((((((((((.....((((..((.(((((((..((.((((..{((...(((((....))))).{,...,,|{({{{{|,..,)))))},.))).))))))...)))))))))..))))......))))))),......,})))))}).)}.

Transcripts

ID Sequence Length GC content
AAGGGGACAGCACUGAGCUCUGCCGCCUGGCUCUAGCCGCCUGCCUGGC… 3164 nt 0.6030
AAGGGGACAGCACUGAGCUCUGCCGCCUGGCUCUAGCCGCCUGCCUGGC… 3285 nt 0.5988
Summary

This gene belongs to the CX3C subgroup of chemokines, characterized by the number of amino acids located between the conserved cysteine residues. This is the only member of the CX3C subgroup, which contains three amino acids between cysteine residues, resulting in a Cys-X-X-X-Cys configuration. The encoded protein contains an extended mucin-like stalk with a chemokine domain on top, and exists in both a membrane-anchored form where it acts as a binding molecule, or, in soluble form, as a chemotactic cytokine. The mature form of this protein can be cleaved at the cell surface, yielding different soluble forms that can interact with the G-protein coupled receptor, C-X3-C motif chemokine receptor 1 gene product. This gene plays a role in a wide range of diseases, including cancer, vasculitis, neuropathies, atherosclerosis, inflammatory diseases, and in human immunodeficiency virus infections. [provided by RefSeq, Sep 2017] CIViC Summary for CX3CL1 Gene

Forensic Context

A study in rats demonstrated that the CX3CL1 was significantly decreased in brain tissue in an Alzheimer's disease-like model and was significantly restored by treatment with astaxanthin-loaded invasomes, correlating with improved memory and reduced pathology [Kandeil et al. DOI: 10.1007/S12035-025-05241-5]. In human traumatic brain injury patients, soluble CX3CL1 concentrations were significantly elevated in cerebrospinal fluid over 14 days post-injury compared to controls, with levels strongly correlating with blood-brain barrier dysfunction [Rancan et al. DOI: 10.01.WCB.0000133470.91843.72]. A study in rats demonstrated that blast wave exposure induces time- and intensity-dependent changes in the CX3CL1 mRNA expression, with a decrease at 2 hours after a 5 psi blast and a larger, longer duration down-regulation after 10–11 psi exposure, while a 14–15 psi exposure caused up-regulation at 2 and 72 hours [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001]. In a separate study of UVB-induced inflammation in human and rat skin, the CX3CL1 was not identified among the significantly dysregulated transcripts [Dawes et al. DOI:10.1371/journal.pone.0093338].