Basic Information

Symbol
CXCL11
RNA class
mRNA
Alias
C-X-C Motif Chemokine Ligand 11 I-TAC H174 IP-9 SCYB11 SCYB9B B-R1 Small Inducible Cytokine Subfamily B (Cys-X-Cys), Member 11 Interferon-Inducible T-Cell Alpha Chemoattractant Interferon Gamma-Inducible Protein 9 Chemokine (C-X-C Motif) Ligand 11 C-X-C Motif Chemokine 11 Beta-R1 Small Inducible Cytokine Subfamily B (Cys-X-Cys), Member 9B Small Inducible Cytokine B11 Small-Inducible Cytokine B11 ITAC IP9
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_005409.5
Sequence length
1479.0 nt
GC content
0.3428

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-313.60 kcal/mol
Thermodynamic ensemble
Free energy: -342.51 kcal/mol
Frequency: 0.0000
Diversity: 322.04
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((.(((((.(((.(((...)))))).)).)))))))))...((.(..((.((....)).))..).))............((((...((((((((((((((......))))))))((((((((((((((((.((((((..(((((((((.(((.....((((((...)))))).....)))..)))))...))))..)))..((.((((.(((.(((.....))).))).(((((....)).))).)))).)).....(((((((..((((..(.((((((((.....((((...((((.............))))((((.......))))........(((((((.........))))))).......................(((((((((((((......(((((((((((.((((((....((..((((((.(((.......)))...))))))...))..))))))))))).))))))....((((((.(((((..(((....)))))))).))))))....(((((((.((................((((((......))).))).....(((((((.........(((((((((.........))))))))).((...(((((((((....)))).))))).))...))))))).....)).)))))))))))))......(((((.........))))).)))))))((((((....))))))....((((((((((((......)))))(((((((((........((.((((((((((((..(((((.(((((........((((((........))))))..))))).))))).))))....)).)))))).))....))))).))))..))))))).((((........))))))))......)))))))).)..))))..)))))))........))).).))))))))).)))))).((((...(((((....(((.....((((((........))))))..............((((((........)))))).............(((((((((.(((((....))).)))))))))))..((((((((..((....)).)))))))).(((((((((((.(((.(((.((((((((..(((((((((..((.(((.(((....)))))).))..)))))))))..)))))........((((....)))).((((((.....((((((.....)))))))))))).))).)))))).))))))))))).))))))))...))))..........((((.....))))(((((.....))))).......................((((...(((((((.((........)).)))))))...))))..(((((((.((((..(((....)))..))))....)))))))......))))))...))))......
Thermodynamic Ensemble Prediction
.((((((.((,((.(({,(((...)))))).)).)),))))))...((.{..((.((....)).))..,.))............,{{{,,,((((((((((((((......))))))))((((((((((((((({.((((((..(((((((((.(({.....((((((...)))))).....)))..)))))...))))..))}..((.((((.(((.(((.....))).}}}.||{{{....}}..},.)))).)).....(((((((..((((..{.((((((((.....((((...((((,,...........,},}{(((.......))))....,,,..,,,,||||,,,....,,})))).....,.{,,.......}},...(((((((({((((.,,...(((((((((((.((((((....((..((((((.{{{.......,})...))))))...})..))))))))))).))))))..,,((((((.(((({.,(((....)))))))).))))))....(((((((.((........,.......{{{|{{{{{,.{|,,.,,),.}}}|((((((.....{,..(((((((((.........))))))))).}}...(((((((((....)))).)))))..,...))))))}.....)).)))))))})})},......{((((.,.....,.))))},)))))))((((({....})))))....((((((({((((......))))}(((((((((..,.....((.((((((((((((..(((((.(((((........((((((........))))))..))))).))))).)))).,,.,,.)))))).)),}..)))))}}))),.))))))).|{||},......}}},))))......)))))))).)..))))..)))))))........))).,.))))))))).)))))){((((({.,,,||}}}}|{{,,.,.((((((........))))))........,|,,..((((((........)))))}.....||{{{,{.{((((((({.,((((,,,,|||.,}}}}}}}}}}..{{{{{{((,,((,,,,||{|||||}}}.(((((({{(((,(((,,{{.{|||||{|,.{{|||||||,,||,||{,|{|,,..)))))),)),.)))))}}}),,)))}),,,,,,..((((....}))).((((((.....{{{{{{.....)))))))))))}.}}},}}}}},.|||}}}}}}}},}}},||||{,.,||||,........{(({....,}}|,{{{||.....)))}}...}}}}..............||||||...(((((((.{{........}}.)))))))...}))},.(((((((.((({..(((,...,)),,))}),,..)))))))......))))))...,,,.......

Transcripts

ID Sequence Length GC content
GUUCAGCAUUUCUACUCCUUCCAAGAAGAGCAGCAAAGCUGAAGUAGCA… 1475 nt 0.3431
GUUCAGCAUUUCUACUCCUUCCAAGAAGAGCAGCAAAGCUGAAGUAGCA… 1479 nt 0.3428
Summary

Chemokines are a group of small (approximately 8 to 14 kD), mostly basic, structurally related molecules that regulate cell trafficking of various types of leukocytes through interactions with a subset of 7-transmembrane, G protein-coupled receptors. Chemokines also play fundamental roles in the development, homeostasis, and function of the immune system, and they have effects on cells of the central nervous system as well as on endothelial cells involved in angiogenesis or angiostasis. Chemokines are divided into 2 major subfamilies, CXC and CC. This antimicrobial gene is a CXC member of the chemokine superfamily. Its encoded protein induces a chemotactic response in activated T-cells and is the dominant ligand for CXC receptor-3. The gene encoding this protein contains 4 exons and at least three polyadenylation signals which might reflect cell-specific regulation of expression. IFN-gamma is a potent inducer of transcription of this gene. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2014]

Forensic Context

A single-cell transcriptomic analysis in a rat model of radiation-induced lung injury identified the CXCL11 as an orthologous rat gene associated with inflammatory processes [Shi et al. DOI:10.17305/bb.2024.10357].