Basic Information

Symbol
CXCR2
RNA class
mRNA
Alias
C-X-C Motif Chemokine Receptor 2 CMKAR2 CD182 IL8RB High Affinity Interleukin-8 Receptor B C-X-C Chemokine Receptor Type 2 Interleukin 8 Receptor, Beta IL-8 Receptor Type 2 GRO/MGSA Receptor CDw128b IL-8R B CXC-R2 CXCR-2 Chemokine (C-X-C Motif) Receptor 2 CXCR2 Gene For IL8 Receptor Type B Interleukin 8 Receptor Type 2 Interleukin-8 Receptor Type B Chemokine (CXC) Receptor 2 CD182 Antigen WHIMS2 IL8R2 IL8RA
Location (GRCh38)
2:218125289-218137251
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Wound age identification Mechanical injury analysis
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_001557.4
Sequence length
2853.0 nt
GC content
0.4788

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-862.40 kcal/mol
Thermodynamic ensemble
Free energy: -917.98 kcal/mol
Frequency: 0.0000
Diversity: 701.48
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((((((((((.(......).)))))))))((((.((((((.....((((.(((...(((((.(((.((.(((...........))))).)))..((((.((((((((((..(((((((((((....).)))))))))).((....(((.(((((..((((.....))))..))))))))....)).....(((((((((...((((((((((((......((((.(((((((....................))))))).))))..(((.(((((((((((((...(((((((....((((((((.........((((((((....((((((((.(((((((((.((((((((.((....(((((((..((((.(((((...((((((.((........)).))))))..((((((.(.(((.((.((..(.(((.....((..(((.(.(((.((..(((((....))))))).))).))))..)).....))).).)).)).))))))))))...((((.....))))......((((.....))))((.(((.....))).))......)))))))).)..)))))))....))))).))).....)).))))))...))).)))).)))).....((((...))))...))))))))..........))))).)))...))))))).........((((....)))).)))).))))))...))).)))))))))))......))))))))))).))..(((....))).(((((....))))).((((((((...))))))))(((((..((((((((...(((....((((..........)))).)))))))))))..)))..))))))))))))...))))......(((((...)))))))))).....))).)))).)))))).))))..((((...))))(((((((.(((..(((.(((((.(((((((((......))).).)))))......((((((..(....)..))))))......((((.(((((((((..((((........))))(((.(((((..(((((((((((..((.((((((((((((.((.(((((..(.(((....))).)..))))).)).))...(((((((.((((((((...((((((((.....((.(((((((((.(.((........)).)..))))))))))).....))))))))...)))))...))).)))))))((((.(((...((.....)).))))))).(((((((.(.((...)).)))))))).....(((((((............(((..(((......))).)))......((((((.......................))))))....((((((((((...(((((.........)))))...))).))))))).((((((.(((((((((((.....(((...........((((.((((...((((((.((.((((((((....(((((((((((...............(((((...(((((.....(..(((((((.((((....((((((((((((((((.(((((..(((..((.(((....((((.((((((.......)).))))..)))).....)))))..)))((((((((.((((............((((((..((((((..((((......((......))....))))......))))))..))))))..........(((((((((...((...))...)))))).)))((((((((....................))))))))(((((((...))))))).....................................)))).)).))))))..))))).))))))).....)))).)))))....(((.............))).((((((((.(((.(((((........)))))))).)))).)))).((....)))))).)))))))..)..))))).)))))...))).))))))))...)))))))))).).))))))))).))))..)))....)))))).)).))).))))))......)))))))...................(((.((((.....)))).)))(((((((.......))))))).................))))))...)))).)).......................((((((.((((..............((....)).........((((((......))))))))))))))..))....(((((((((((........((((..(((((.(((.....)))..)))))))))..))))))))))).((.((.....)).))...((((((((.((.(((..((((((.....(((....))).....)))))).....))).)))))))))).(((.((((......)))).)))........)))))))))))))))).))))))))).))).)))).))))).)))))))))))))....((((.((((((((((.(.((((((.........)))))).).))))))...(((.(((.((((...))))))).)))..((((.((.((((((((..(((((.....)))))...)))))))).))...)))).(((((........))))).....)))).)))).....(((...((((((((....).)))))))))).((((.((......))))))......((((((((((((......)))..........)))))))))(((........))).))))).
Thermodynamic Ensemble Prediction
..(((({(((((((((.,,.....},))))))))){(((.((((((.....((((.(((.,.||((({(({.{{,(({.......,,,,}}}}}.}}|,,((((.((((((((((..(((((((((({....).)))))))))).,,....(({{(((((,.((((.....}}))}|}}})))}}.,,,||....,{,(((((({...|||(((((((((,,,...((((.(((((((................|...))))))).))))..{{{.,{|{(((({((((.,{{|{,((({{{{(((((({.(((((.....(((((.,.....))))).},.)))))|||||,|{{(((.({....(((((((.,{(((.(((((...{(((((.((........)).)))))}..((((((.(.(((.((.((..{.(((.....((..(((.(.(((.((..(((((....))))))).))).))))..)).....))).,.)).)).)))))))))),,.((((.....))))...||.{(((,...,))))((.{({.....))),),.}},,.)))))))).)..)))))))....))))).)})}|{|{(|{{,,,,....,}}}}||||{|||||,,..}||}}}))))}}}.,,,||||....,})}...|||}||,,,..,,.,.)}}..}.....((((....)))).)))),,))))),..})),)))}}))))))).....}}})))))))).))..,,,....,}},((({(....))))}.{(((((({...)))))))}{{(((..((((((((...(((....((((.,,.....},)))).)))))))))))..)))..}}))))))))))...}}))...,|,,,,,|}.}))))))))))||...))).)))).)))))).)))}..{,,,...,,}|(((((((.(((..(((.{((((.(((((((((......))).).)))))..|...((((((..(....)..))))))...,..{(((.(((((((((..((((........))))(((.(((((,.{((((((((((..((.((((((((((,..{{.((({{..(((((....||}{|..,,)),}))}))}..(((((((.((((((((...((((((((.....((.(((((((((.{.((........)).,..))))))))))).....))))))))...)))))...})),)))))))((((.(((...((.....)).))))))).(((((((.(.({...}).)))))))).....(((((((.{{{((((((((.(.(((({,(({.,(((.,{,...,|,}}}}||}}((((((..,,.{{.(((({....))))).))|(((((((((...(((((.........)))))...))))}}))))|{{,.{({,(((((((((.,({.....(((.((..((((({{(((((........,(((,..(((((((((((.((((..................,,..{{(,..((((((..({....))..}))))).,.,,}{(((((((((((((((.((((({{,((({((((,,....|}}}},))},))}}|...(({.((({,...}}})}})),..|||{|((((((((.((((..........,{((({,,,,(((,((,,.{,..,....||....}})),,)})))}.,,,..,,,,,,,})||||,.......},,{((((((((...((...))...)))))).))}((((((((....................))))))))(((((((...)))))))..............................,,,,...)))).)).)))))),}))))).))))))).....)))).)))))))).)))))........))))))))))))))))))))..)).)))..}.)).)))))))|||{.{{{..,,..))).|,|}}{(((((...))))))},,.,}))))},},.)))))).....,|,..,,)),.)))).).)))))))).}})......|{|},,}})|{{{{....}.)))}..))))))}.............,,,...,,|.,,,.....,}),}.}}}(((((((.......))))))).............,...))))))...)))).))..,{({({...,.,.,,,.....,,.(((((((({,.....,.....}||....||...{{,...((((((......))))))},.))),,..}}....(((((((((((......{.((((..(((((.(((.....)))..)))))))))}.))))))))))).{{.((.....)).}}...{{{{{{{|.|,.|||||||||||.....(((....))).....}|||||..||,,||,|,}}}})))).,{|,|,||},},..}}}}.},,........)))))))))))))))).))))))))).))).)))}.))))},))))))))))))),...((((.(((((((({(,(,(({{{(,{.,,....,)))}),).}))))),..(((.(({,((((...))))))).))}..{{((.((.{(((((((..{((((.....))))}...)))))))}.))...)))}.,{{{{.,......}}}},..,..)))).)))).,,,|(((,,,((((((((....).)))))))),,.((((.{(......))))))......{{{{{{{(({({......},}..,....,..}}}}}}}}}(((........))),))))).

Transcripts

ID Sequence Length GC content
NM_001168298.2 NCBI
AGUGGUGAUAGCUGAGAAUAUGCAGCCGUUUUCUCCUUCCUGGGUACAG… 2656 nt 0.4767
NM_001557.4 NCBI
AGAGACAGAAGGUGGAUAGACAAAUCUCCACCUUCAGACUGGUAGGCUC… 2853 nt 0.4788
Summary

The protein encoded by this gene is a member of the G-protein-coupled receptor family. This protein is a receptor for interleukin 8 (IL8). It binds to IL8 with high affinity, and transduces the signal through a G-protein activated second messenger system. This receptor also binds to chemokine (C-X-C motif) ligand 1 (CXCL1/MGSA), a protein with melanoma growth stimulating activity, and has been shown to be a major component required for serum-dependent melanoma cell growth. This receptor mediates neutrophil migration to sites of inflammation. The angiogenic effects of IL8 in intestinal microvascular endothelial cells are found to be mediated by this receptor. Knockout studies in mice suggested that this receptor controls the positioning of oligodendrocyte precursors in developing spinal cord by arresting their migration. This gene, IL8RA, a gene encoding another high affinity IL8 receptor, as well as IL8RBP, a pseudogene of IL8RB, form a gene cluster in a region mapped to chromosome 2q33-q36. Alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2009]

Forensic Context

A study in mice and humans demonstrated that the CXCR2 mRNA, but not its protein, is significantly elevated in antemortem skin contusions compared to intact skin and postmortem injuries, serving as a potential marker for vital reactions [He et al. DOI:10.1007/s12024-018-9969-7]. In mice, this increased mRNA expression persisted up to 72 hours postmortem, while in human autopsy samples, elevated levels were detected up to 48 hours after autopsy in four out of five cases, indicating its forensic applicability for determining wound vitality. A study in rats demonstrated that the CXCR2 was significantly upregulated in the right ventricle following acute right heart failure induced by pulmonary artery banding [Cao et al. DOI:10.1177/2045894019879396]. In a separate rat model of mild blast traumatic brain injury, mRNA expression of the CXCR2 was transiently increased at 2 hours after a 5 psi blast exposure and showed earlier, greater, and sustained up-regulation following higher intensity (10-11 psi) exposures [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001].