Basic Information

Symbol
CXCR3
RNA class
mRNA
Alias
C-X-C Motif Chemokine Receptor 3 CKR-L2 G Protein-Coupled Receptor 9 CMKAR3 IP10-R CD183 MigR GPR9 Interferon-Inducible Protein 10 Receptor Chemokine (C-X-C Motif) Receptor 3 C-X-C Chemokine Receptor Type 3 IP-10 Receptor Chemokine Receptor 3 CD183 Antigen Mig Receptor CXC-R3 CXCR-3 CD182 Mig-R
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses Mechanical injury analysis

MANE select

Transcript ID
NM_001504.2
Sequence length
1615.0 nt
GC content
0.6217

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-674.00 kcal/mol
Thermodynamic ensemble
Free energy: -701.56 kcal/mol
Frequency: 0.0000
Diversity: 316.18
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....(((((.(((((((((((((((((....((.(((((((((((((((((((((..(((..((((((((.....))).)))))....((((.....).)))...((((((((((.....((((.....(((((((((.((....)).)))))..(((((.....)))))))))...)))).((((.(((((((((((.....(((((.........)))))..))))).((((((....((((...........)))))))))).))))))..)))).))))))))))((((((((.((..(((.....))))).))))))))..........(((((.((......)).)))))....))))))))))))...((((((......))))))(((((....))))).(((((((...((((..(((.(((((......))))).)))........(((.((((......(((((((..((..(((((......)))))...))..))).)))).....)))).)))...(((.((......)).)))))))...)))))))((((...))))....))))))).)))))))..))))))))..............(((...........)))((((.((((((((..(((......)))((((.(((((((......((.((....)).))((((((.(((.((((((((((((((((.((.(((.(((.....)))))))).)))((.((((((.....)))))).))...........(.(((.((((...)))).)))).)))))))))))))))).)))))))))))))))))))))))))))))....)))))))))(.(((.((........)).))).))))))....(((....)))(((((.((.(((((((.((....))))))))).(((((((((((((((((((.....))))))....((((..(((((((..((((((((.....((((.((((.(((((((((.((((((((..(((.(((((.((((..((((...))))..)))).)))))))))))))...(((.(.((((((((..((((((((..(((((...(((((((....)))))))..)))))((((.((((((.......)))))).))))((((((((.((((.........(.......).........)))).))))).))).........((((.(.((((...((((...............((((((((((..(.((((..((....))....)))))..))))))).)))........(((((..((((((.(((....))).).))))))))))...)))).......)))).).))))))))))))))))))))).)))((((...(((((((....................))))))).))))..)))))))))))).)))).))))((((......((.(((........))).)))))).))))))))..)))))))..))))...((((.(.........).))))..........))))...)))))))))......................))))))).
Thermodynamic Ensemble Prediction
.....{,,,,.,(({(((((((((((((....((.(((((((((((((((((((((.,(((..((((((((,.,,{|}}.}}))}....({{{.....,.}}}...((((((((((.....((((.....(((({{{{({.,.....,.))))}..(((((.....)))))))))...)))).((((.(((((((((((.....(((((.........)))))..))))).((((((....((((...........)))))))))).))))))..)))).))))))))))((((((((.((..(((.....))))).))))))))..........(((((.((......)).)))))....))})))))))))...((((((......))))))(((((....))))).(((((((...((({(((((..{{((...|,||||||,|}}.....................((((((....}))))){({...{{,,,|||..,},..))}.,,||{{{..,)))})})}|,|{{.||......))}))))))}...)))))))((({...})))....))))))).)))))))..)))))))),,,,,.,.......(((...........|}}(({((((((((((..(((......}))(({(((((((({......,,.,(,...}},))((((((.(((.((((((((((((((((.((.(((.(((.....)))))))).)))((.((((((.....)))))).)}......{||{{,.{{{.((((...)))).)))),)))))))))))))))).)))))))))))))))))))))))))))))...,|||||||||({{{(.((........)).))),))))))},..(((....))),{{|||||.((((((((((....))))))))}.((((((((((((((((((((...(((((((...(((((((((((.,,.{(,,{(,.((....((((.((((.(((((((({{((((((({..(({{(((((.(((({.((((...))))}}}})).)))))))))))))...(((.(.((((((({.,((((((((..(((((...(((((((....)))))))..)))))((((.((((((.......)))))).))))((((((((.((((.........,.......}...,.....)))).))))).))).........((((.(.((((...((({...............((((((((((..(.((((..((....))....)))))..)))))))}}))........(((({.,((((((.(((....))).).))))))))))...)))).......)))).}.))))))))))))))))))))).))),{{{...{{{{{{{................,,,,||}}}}}.))))},)))))))))))).)))).))))|,.))..}}.}..}}...)))))))))))..,|,...),.))))))))))))}}((((.....)))).........................)))),..})))))))).................,,},.,)))))).

Transcripts

ID Sequence Length GC content
ACAAGCACCAAAGCAGAGGGGCAGGCAGCACACCACCCAGCAGCCAGAG… 1859 nt 0.6138
ACAAGCACCAAAGCAGAGGGGCAGGCAGCACACCACCCAGCAGCCAGAG… 1615 nt 0.6217
Summary

This gene encodes a G protein-coupled receptor with selectivity for three chemokines, termed CXCL9/Mig (monokine induced by interferon-g), CXCL10/IP10 (interferon-g-inducible 10 kDa protein) and CXCL11/I-TAC (interferon-inducible T cell a-chemoattractant). Binding of chemokines to this protein induces cellular responses that are involved in leukocyte traffic, most notably integrin activation, cytoskeletal changes and chemotactic migration. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. One of the isoforms (CXCR3-B) shows high affinity binding to chemokine, CXCL4/PF4 (PMID:12782716). [provided by RefSeq, Jun 2011]

Forensic Context

A study in rats demonstrated that the CXCR3 was significantly downregulated in the prefrontal cortex at 2 hours after a binge methamphetamine regimen, indicating region-specific transcriptional changes in microglia and infiltrating macrophages [Kays et al. DOI:10.3390/brainsci9120340]. A review of single-cell sequencing in mice following myocardial infarction identified the CXCR3 as a characteristic marker for effector T-cells, specifically within the CD4-C2-CXCR3 cluster, and noted its downregulation in the PFC at 2h post-METH as part of a broader inflammatory response [Bian et al. DOI:10.3892/mmr.2025.13680]. A study in rats demonstrated that the CXCR3 (Cxcr3) mRNA and protein were markedly upregulated in cortical white matter astrocytes after 10–11 psi blast wave exposure, with little change after 5 psi, correlating with vascular injury and inflammatory pathways in mild blast traumatic brain injury [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001].