| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCACACCUCUCGGUGCAGAUUGCAAAGCGCCUUCCGUUGCGAGAGCUGC… | 2170 nt | 0.6521 |
The protein encoded by this gene is a member of the PAR bZIP transcription factor family and binds to specific sequences in the promoters of several genes, such as albumin, CYP2A4, and CYP2A5. The encoded protein can bind DNA as a homo- or heterodimer and is involved in the regulation of some circadian rhythm genes. [provided by RefSeq, Jul 2014]
A study in mice demonstrated that the DBP is markedly downregulated in cardiac endothelial cells during myocardial infarction progression, as confirmed by scRNA-seq, microarray analysis, and in vivo validation via qPCR, western blot, and immunofluorescence [Mao et al. DOI:10.1016/j.bbrc.2025.151820]. In a separate investigation of radiation-induced gastric injury in mice, microarray and qPCR analyses identified the DBP as an upregulated mRNA in irradiated gastric tissues [Chen et al. DOI:10.1177/1559325819886766]. A study in humans analyzing 21 candidate mRNA markers for blood deposition time estimation identified 11 with statistically significant 24-hour expression rhythms, but the DBP was not selected as a significantly rhythmic marker in this investigation [Lech et al. DOI:10.1016/J.Fsigen.2015.12.008].