Basic Information

Symbol
DBP
RNA class
mRNA
Alias
D-Box Binding PAR BZIP Transcription Factor DABP D Site Of Albumin Promoter (Albumin D-Box) Binding Protein Tax-Responsive Enhancer Element-Binding Protein 302 Albumin D-Element-Binding Protein Albumin D Box-Binding Protein D Site-Binding Protein TaxREB302
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Cause of death analysis Time since deposition estimation

MANE select

Transcript ID
NM_001352.5
Sequence length
2170.0 nt
GC content
0.6521

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-976.50 kcal/mol
Thermodynamic ensemble
Free energy: -1015.81 kcal/mol
Frequency: 0.0000
Diversity: 553.13
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((....)))).....))).....(((((((((..(.((((((((((((((((...((((.((((..((...((((....)))).))))))((((......)))).(((((((.(((..((((.....))))(((((((.(........).)))))))(((....(((..(((...)))..))).))).......))))))))))................)))).)))))))))))))..))).)..)).))))))).((.(((.......))).))....((((((...(((((((......(((((((((((((((..((.(((((((.((((.(((((((.((.((..((((......))))..)))).)..)))))).)).))))))))).))...((((.((((((((.(((((((((((((((((((((.((((...(((((....))))).(((((.(((.((((....))))((((.((((((((.(((..(((.........)))..))))))))))).)))).))).)))))..((((((((.(((((..(((.((.....))))))))))..(((((..(((((.(((((((..(((((((..(((((.(((((((((((.(((((((((((((((((((((((((.((...))))))))((((((...((.((((((((((((.(((....))).)))..)))))..)))).))...)))))).)).))))..))))).)).....)))))))))))))..)))).))))))))).)))...)))))))(((((..(((.((((((..(((((..((((....)))).)))))))))))))).)))))....)))))...))))).)))).)))))))).)))))))))))(((((.((....((((...))))...)))))))......(((((((((.((((((((.((.....((((((.....)))))).................(((((((((.(((((((...((...(((...((((..(((...((((((...))))))...))).(((((....)))))............))))...)))..)).)))))))......((((.((.((((((((((..(((((.......((.((((((.(((.....(....(((.((..(((....))))))))....)))).)))))).))....(((.......)))(((.(((((((((((.....)))))(((..(((((....)))))..)))..)))))).)))..((.((.(((.(((....((.((((((((..((.......))..)))))))).))...))).))).)).)).))))).(((..(((((((.....)))))))..).))...........)))))))..))).))))))(((((....)))))..)))))))))..)))))))...(((.((((.((((......)))).)))).))).........((((((.(((((((((....))))).)))).)))))).))).))))))))).)))).).))))).((((((((.(((...(((((((((.........((.((......)).))....(((.(((.....))).))).((.((.((((((.((((((......((((.((((((((.(((...))))))))))).).)))....((((.(((((((..(((.(((((((.((((...((.(((((((((..(((....((((.((..(.((((((((((...(.((((((((....).))))))).).)))))))))))..)).))))...)))(((((.(((.(((....((((...(......)...))))....)))))).)))))))))))))).)))).)).)))))))...)))))))))).))))))))))..)))))))).)).(((((......))))).)))))))))...)).).))))))))...))))).))).))))...((((..........)))).......)))))))))))))))((((.......))))(((((.....((...((((((((...((((...)))).)))).))))...)).....))))).)))).)))..)))))).....
Thermodynamic Ensemble Prediction
((.((((((((((((((((.(((({.((((,{{({.(((((((,,,{({(,.,,})))},((({.,,))}}{{...{|||,,,,}})),))))..{(((......)))}...((((((......))))))..{{..(((((((.(........).))))))))).....,,,.,||||..,})},),}}))))....))))))))))),............(((((({(,((((((|((((((.((((((...)))))).))))))|{,.......|{{{{....,|))).({{....))),......((((((((((((((({.((.(((((((.((((.(((((({.((.((..((({......})))..)))).}..)))))).)).))))))))).)),..((((.((((((((.,.,.(((((({((((((((((.,(((.{,,{(({.{{{((((|.(((,((((((((,,{,{{||(|((((.((((((({{(((..(((.........)))..))))))))))).,))}..||{,||||..{|||||||}(((({|{(({.{,..,{{||||||}}||,,({,|.,,|||||}|{(((({.,(((((((..(((({,(((({((((((.((((({((({((((((({{{(((((.((.,,|||}}||(((((((...((.((((((((({((.(((....))).))}..))))}..)))).))...))))))))).}||}.,||,}}.)),,,.,))))}))})))),..)))).))))))))).)))}}.)))))||(((((..({{{((((((..{((((..((((....)))).)))))))))))))).))))),}..,,})))))}),))}))))}))))))))}).))),))))),)))).)))))))))))..{{.....))((((((.,,({(((((((((.((((((((.((...{,((((((.....))))))...,.............(((((((((.(((((((.,.(({.,,{{..{((({..(((...((((((...))))))...))),(((({....))))}.........,,,)}}}..,.))}.,,.)))))))......((((.((.((((((((((..(({((.,.....((.((((((.(((.....,....{((.(({.(({..|||)})|))),..,|))).)))))).,),...,||.......|||({({(((((({((((,,...}||},(((..(((((....)))))..)))..}}))}}.)})},||,||.|||,(((....((.((((((((..((.......))..)))))))).))...))).))),))})).))))}.{,,..(((((((.....)))))))..}.}}....,,...,.)))))))..))).)))))){((((....))))}..))))))))).,)}))))).,{{....|||.,.{{,,,....,}},},}|,,,..........(((((((((({(((((....))))).)))))))}))).))).))))))))),)).,.)))))){.((((((((.(((...(((((((((.....,.,.{{,,.....,,,},,,....{((,{({,{{,,|||.|},.....{|{|||||,{{{{||}....,((((,((((((((.(((,,,||||||||}}|,}{|},....{|||.(((((((..(((.(((((((.(({{...((,(((((((((..{((....{||{,((,{(,((((((((((...(.((((((((....)}})))))).).)))))))))},..}),))))},.,,,{((((.(((.(((....((((...(......}...))))....)))))).)))))))))))))).})))}}).)))))))...)))))))))).)))))))))}..))))))}},||||||||...},)))).,.)))))))))...)).).))))))))}}.))))).))).))))...((((..........)))).......))))))))))))))))))))).....)))))))).,.......{.((((((((...((({...}))).)))).)))),}))))))..(((.((((.......))))...)))..

Transcripts

ID Sequence Length GC content
GCACACCUCUCGGUGCAGAUUGCAAAGCGCCUUCCGUUGCGAGAGCUGC… 2170 nt 0.6521
Summary

The protein encoded by this gene is a member of the PAR bZIP transcription factor family and binds to specific sequences in the promoters of several genes, such as albumin, CYP2A4, and CYP2A5. The encoded protein can bind DNA as a homo- or heterodimer and is involved in the regulation of some circadian rhythm genes. [provided by RefSeq, Jul 2014]

Forensic Context

A study in mice demonstrated that the DBP is markedly downregulated in cardiac endothelial cells during myocardial infarction progression, as confirmed by scRNA-seq, microarray analysis, and in vivo validation via qPCR, western blot, and immunofluorescence [Mao et al. DOI:10.1016/j.bbrc.2025.151820]. In a separate investigation of radiation-induced gastric injury in mice, microarray and qPCR analyses identified the DBP as an upregulated mRNA in irradiated gastric tissues [Chen et al. DOI:10.1177/1559325819886766]. A study in humans analyzing 21 candidate mRNA markers for blood deposition time estimation identified 11 with statistically significant 24-hour expression rhythms, but the DBP was not selected as a significantly rhythmic marker in this investigation [Lech et al. DOI:10.1016/J.Fsigen.2015.12.008].