| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUAUAUCAAGACCUACAGCCCUUGGGAAGUGCAUUUCUGCAUUCGAAGA… | 1498 nt | 0.4559 | |
| GCAUUUCUGCAUUCGAAGAAGAAUCUGAGAGAAACCUGACGCAGGGAGC… | 1953 nt | 0.4572 |
This gene encodes a seven-pass transmembrane protein that is primarily expressed in dendritic cells. The encoded protein is involved in a range of immunological functions carried out by dendritic cells. This protein plays a role in osteoclastogenesis and myeloid differentiation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
A study in rhesus macaques demonstrated that whole-thorax irradiation induced radiation-induced lung injury, with transcriptomic analysis identifying DCSTAMP (dendritic cell-specific transmembrane protein) as an upregulated transcript specifically in nonsurvivors, where it is implicated in promoting macrophage infiltration and fusion [Priyanka Thakur et al. DOI:10.1016/j.ijrobp.2021.03.058]. A study in mice demonstrated that Gpr174 deficiency significantly upregulated the DCSTAMP transcript in septic mice following cecal ligation and puncture injury, which was associated with an improved outcome, reduced multi-organ damage, and a phenotypic shift in immune response pathways [Wang et al. DOI:10.3389/fimmu.2021.789141]. In a separate study in nonhuman primates, RNA sequencing of lung tissue from irradiated rhesus macaques identified the DCSTAMP as one of the top upregulated transcripts specifically associated with early mortality, where its expression was linked to increased macrophage infiltration and fusion [Thakur et al. DOI:10.1016/j.ijrobp.2021.03.058].