Basic Information

Symbol
DCSTAMP
RNA class
mRNA
Alias
Dendrocyte Expressed Seven Transmembrane Protein FIND Transmembrane 7 Superfamily Member 4 DC-STAMP TM7SF4 Dendritic Cells (DC)-Specific Transmembrane Protein Dendritic Cell-Specific Transmembrane Protein IL-Four-Induced Protein IL-Four INDuced HDC-STAMP Dendrocyte-Expressed Seven Transmembrane Protein DC-Specific Transmembrane Protein IL-Four (IL-4) Induced IL-4-Induced Protein
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Sudden death from respiratory system disease Sudden unexpected death diagnosis

MANE select

Transcript ID
NM_030788.4
Sequence length
1953.0 nt
GC content
0.4572

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-588.60 kcal/mol
Thermodynamic ensemble
Free energy: -624.66 kcal/mol
Frequency: 0.0000
Diversity: 558.60
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((....)))((((......))))..((((((...(((((.(((((((....(((((..((((((((((((((((.(((((((.........)))))))))).)))..((((((((((((((((((..((((.....)))).))))))))..((((((.((.((((((...((.(((((.((((.........((((((((.((.((((....)))).))......)))))))).)))).))))).))....((((.((((((.(((((...(((((.(((.(((((.......................(((((((.(((((((.((((((....)))))).).)))))..).))))))))))))))))))))))))))))))).))))...............(((((.((.....))...))))))))))).)).))))))..(((((...(((..(((((.......)))))..)))...))))).....((((((....((((...)))).))))))(((.((........))))))))))))))).((((...)))).....(((((((((.(((..(((..((((.....))))..)))....))).).))))))))...)))))).)))).)))))....(((((((.((.....)))))))))))))))).)))))..((((..((((...(((((((........)))))))..)))).))))...(((((.(((((((((((((.....(((((.((............)).)))))...))))).))))......)))).)))))(((((((((.......(((((((.((((.((....)).......((((((((((((((((...(((........)))((((((((...(((((......(((.....)))(((((((((((((((.((((....................)))).(((((((((.((((.(((..((..((((...))))..))..)))))))..)))))))))....(((((((((((((.(((.((((((.........(((((((.......((((((.(((.(........).)))...)))))).......))))))).)))))))))((((((((..............((.((((((.(((((((((...(((((((((.........(((((((((.(((...(((((....)))))....................))))))))))))((.(((((((((......)))))))))..))((((.((.....)).))))...(((((((............))))))))))))))))..(((....)))(((((((((((((((((...)))))((((((...(((((...((((((......)))))).))))))))))).((((((..((....))..))))))))))))............))))))....................))))))))).)))))).))..............)))).))))...((..((((((((((((((...)))).((((......))))....(((((((((...(((((.((.............)).)))))....)))).)))))....(((((((((((...((((...)))).)))))))))))....))))))))))..)).....(((((.....))))))))))))...)))))).(((((......)))))..)))))))..((((.......))))...........))))))))...(((....))).))))).(((....))).....))))).))).............))))).)))))....))))))..(((....)))..))))..)))))))))))))))).....(((....)))...)))))).........
Thermodynamic Ensemble Prediction
(({....})).{{{......}},|(.((((((...{{.....((((((((.((({.{{((((....{(((((,{{.(((((((.,......,))))))),},.))))))}},,)}.}}||,(((((({((((.....}))}...,|}|||(((((((((,{({,((((,..,,.{((((.((((.........((((((((.((.((((....)))).))......)))))))).)))).))))).|,.,,.(((((((((.((((({{(((...}|||{|}|}(((((({{....{((((((.,((((((((((((,(((((((.((((((....)))))).),,))))..),)}|||||.{{(((({({,{{{{{,{{{.((((,...,)))),,........{{|||,||.,,,,)}...}}}||,,..||,,|||||...,.||{{{...{{{..(((((.......))))}..},}...|||||..,,.((((((....((((...)))).)))))).,}}||...|}}}}}}}||(((((..((((((((((((((((((((((((((((((,,,((((((((((({,{{{({{.,{|||....|||.((,{((({.{{{{,,,.(((.{{{{(..((((..((((((,,((.....)))))))}),...))))..)))}.)))})}),))))}||((((({,{{{{{,||},}|,..|||...,))),}..,}}},}}}}}.....))))}}}.})))))))..{,,,|,...,.}}},,,{{{,{{(((.....,,,..}}}}).))},,|||||}}}|....,{{{..,,,|}|}||{|}|},}}||,,,,|{{{({...((((((((,,,(,,..,,,....})}}}}}.,,,..}}}}}..,|,.}|||......|{{||..|..,,,)},))))}...,,,}}}...,.,}},,.|}}},(((((((((.((((.(((..((..((((...))))..))..)))))))..)))))))))..,...,,.)))))))))))..))))).)..)))}}..}},}))))))}))))))}....)))))))}...,.,}..,,((((((.(((((.(((((({{,(({...,,((,(((((,,............{{.{{((((.{((((((({,,,{((((((((,{{,,....,||{|,,||,{({|||{({({.{{{||},,..........}}}},.....,}}}})))}))){{.{((((((((......))))))))),.))((((.((.....)).))))...(((((((............)))))))}||||||||.,(((....}}}(({{({((((((,((({...})))|((((((...(((((...((((((......)))))).))))))))))),((((((..((....))..))))))))))))...,,,,.,,,}}))))}.....,..............|}))))))}.))))||.|}....,,,,|.,,,,)))),,})).,,{{..(((((((((({{{{,..||}}.{{({.,....)})},,..,{{,(((((.,.(((((.{(.............,}.)))))..,.)))))}))||,...(((((((((((...((({...}))).))))))))))).,,,))))))))))..}}.....(((((..,,,|||}}.,,)))}},})))))))))))))))...))))).)))))}.|||((((.......)))).....,.......,}}..},..(((....))).)).))))))))).,))}}.,)).}))))))))..,..}}}},,},})}))))...,,{.....,,,((((((((......))))))))........)))))))))))......))...)))))).)}......

Transcripts

ID Sequence Length GC content
AUAUAUCAAGACCUACAGCCCUUGGGAAGUGCAUUUCUGCAUUCGAAGA… 1498 nt 0.4559
GCAUUUCUGCAUUCGAAGAAGAAUCUGAGAGAAACCUGACGCAGGGAGC… 1953 nt 0.4572
Summary

This gene encodes a seven-pass transmembrane protein that is primarily expressed in dendritic cells. The encoded protein is involved in a range of immunological functions carried out by dendritic cells. This protein plays a role in osteoclastogenesis and myeloid differentiation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]

Forensic Context

A study in rhesus macaques demonstrated that whole-thorax irradiation induced radiation-induced lung injury, with transcriptomic analysis identifying DCSTAMP (dendritic cell-specific transmembrane protein) as an upregulated transcript specifically in nonsurvivors, where it is implicated in promoting macrophage infiltration and fusion [Priyanka Thakur et al. DOI:10.1016/j.ijrobp.2021.03.058]. A study in mice demonstrated that Gpr174 deficiency significantly upregulated the DCSTAMP transcript in septic mice following cecal ligation and puncture injury, which was associated with an improved outcome, reduced multi-organ damage, and a phenotypic shift in immune response pathways [Wang et al. DOI:10.3389/fimmu.2021.789141]. In a separate study in nonhuman primates, RNA sequencing of lung tissue from irradiated rhesus macaques identified the DCSTAMP as one of the top upregulated transcripts specifically associated with early mortality, where its expression was linked to increased macrophage infiltration and fusion [Thakur et al. DOI:10.1016/j.ijrobp.2021.03.058].