Basic Information

Symbol
ADRB2
RNA class
mRNA
Alias
Adrenoceptor Beta 2 B2AR ADRB2R ADRBR ARB2 BAR Adrenergic, Beta-2-, Receptor, Surface Beta-2 Adrenergic Receptor Beta-2 Adrenoreceptor Beta-2 Adrenoceptor Adrenoceptor Beta 2, Surface Adrenoceptor Beta 2 Surface Catecholamine Receptor BETA2AR
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Cause of death analysis

MANE select

Transcript ID
NM_000024.6
Sequence length
2013.0 nt
GC content
0.5057

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-666.60 kcal/mol
Thermodynamic ensemble
Free energy: -703.31 kcal/mol
Frequency: 0.0000
Diversity: 595.46
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((((.(((((((...((((....((((.((.....(((..((...))..))).....)))))).....))))(((((..((........))..))))).........)))))))......((((((((((((...(((((((...))).))))..)))).(((((..(((.((.((((((((((((....((((((..............))))))..)))))....(((....)))..)))))))...)).)))))))).))))))))..(((.((.....)).)))..)))))((((((..(((((((.(((((((((.(((((((...(((((((.((((((.....((((..(((..((((((((((.((((.......))))))))))))))..)))(((((((....(((((.((((......(((((((.(.(.((((((((((.....)).)))))))).)).)))))))....))))))))).(((((((........)))))))....((((((..(((((((((((((..(((........((((.(((((((.((((((..(((..........)))..))))))))))))).))))........)))..))))..........)))))))))..)))))).(((((((((((((....((((((.(((........))).)).))))))))))).....))))))......))))))).(((((...(((...))))))))..(((........)))..))))))))))...)).)))))(((.....)))....))))))))))))))))..((((.((((....(((((((((((((((((((.(((.(((.(((((.((((((((((((((.(((((((....)))..)))).))))...)))...)))).)))((((((((.(((((...((((.....))))))).)))))..)))))..(((((.((..(((((((((.((....)).))))).....))))..))..)))))..)))))..)))))).)))))(((........)))..((((((..(((.((((.(((..........(((((((((((((.((((......))))....)))...))))))..(((......))).((((........((((((...((((((....((((...((....))..))))....))))))....))))))........))))))))((((((((...))))))))))))))).)))....)))))).........)))))))))...)))))...))))))))((((.((............)).))))(((((....(((.((((((((...((((((........)))))).)))))))).).)).........)))))..(((((((((((..(((((((((((..((((((....))))))((((((.(((((...........(((.(((.........................))).))).........(((..(((((..((((((..(...........(((((((((......))))))))))..))))))..)))))..)))..))))))))))).((((....))))........)))))))))))....)))))))))))(((((((((.....(((((.(((.......(((((((((((....))).)))))...))).......))))))))))))))))).....((((...(((((((.((((((((.(((.((((((...)))))).)))....((((((.....))))))....))))))))))))))).....)))))))))))..)))))).(((((((((.((((((....((((.....................))))........((.((((......(((((((....)))))))))))..))..))))))..)))))))))....................
Thermodynamic Ensemble Prediction
,,..,{.((((((((,.((((((((((,(,(((,((((((((((((...(,((|,,,({{((((....{{{{{||,{{(.,((((((((,..(((((({,{((((((((.,.,((.{{......((((((((((((...(((((((...))).))))..)))).(((((..(((.((.((((((((((((....((((((,,........},..))))))..)))))....(((....)))..)))))))...)).)))))))).)))))))).{(((.,|{{{.....,)}}.)))}....,}))..}.))))))))))))))).,,(({{,|..,,}))))}....}))))))),,)}}}}.))}||,{,,,|}||||}...,}.),))),})))))})}}),)}},|,}}}.|.(((((.((({......(((((((.{.{.((((((((((.....)).)))))))),)}.)))))))....})))))))),((((((({....}}.,))))))...{(((.((((((((((.((,..((((((.(((((..{{{.((((((.((......)))))))).(((((((((.{|({{{{}|||({{{||,||..,...}).}.,}},,..........(((((((.(({{{,((,.(((((((((((((.,{.((((((.(((,..,,.,}})).)}.}))}))))))).....))))))..}}.,))),.)).))))))).{(({{{..({{((((.(((........)))..|,{{{{(.|,...{{(((({.....})))}.....}}}...,,,)}}))||........((((......})))....}}}))))....)))})}..},,,.,..))))))))}}},)))))))))))..}.)).))))))).))).)))})))))))))))))))||{||,{,,.......(((..(((((((({{{((((.(((.((((...(((.((((((((.((....)).))))){((,,((.((.....)))))))),.((((((((({,,....(((({,,..{,.,,..}}.,)).))))}..,.,,{,.,,...,,,.,,|{||||||,{{{{(((,.{{{.{((({..{({{.{......,}})}}}....}))))}}),..}}}}..{{((((...({{(((....{{{{..,{{.,,,)},,)))}....))))}),,..}}}}||{((((((((((((.(.((((((((......,,|({{{{.||,,},|{{{((,.|{..{,........}.),,)).))))))..,}).))))).((((.((............)).))))..)))))))),})))))))))))){|||{{,},,.,..)}}))).,,)))))))))).......,{.{(((({,(((((((((((..(((((((((((..((((((....)))))),{((((.,{(((,.,,,,,,....{{.{{,..,......................,}).))),..,,,,,{||||{,,.,{{{.,,.,,,,.,{{{{{{{...(((((((((......))))))))).,||||}}|,,|||||..,,.}}))))))))))),{(({....))))........)))))))))))....))))))))))}|((((((((.....((({{{(((.....,,((((({{((((....)))).}))).,,})).......))))))))))))))))}....{((((...((((((({((((,((({{....||||}.}})))),..{(((...((((((,...,)))))).)))),,)))))),,))))}..{(((((...)))))}.....,...))))))},.))).))).,)))}..))).))))))))))).)))..)))|{(((((((...{.((((.((((((((....)))))..))))))))...)))))))}},.{((((......))))),,),,,,,,

Transcripts

ID Sequence Length GC content
GCACUGCGAAGCGGCUUCUUCAGAGCACGGGCUGGAACUGGCAGGCACC… 2013 nt 0.5057
Summary

This gene encodes beta-2-adrenergic receptor which is a member of the G protein-coupled receptor superfamily. This receptor is directly associated with one of its ultimate effectors, the class C L-type calcium channel Ca(V)1.2. This receptor-channel complex also contains a G protein, an adenylyl cyclase, cAMP-dependent kinase, and the counterbalancing phosphatase, PP2A. The assembly of the signaling complex provides a mechanism that ensures specific and rapid signaling by this G protein-coupled receptor. This receptor is also a transcription regulator of the alpha-synuclein gene, and together, both genes are believed to be associated with risk of Parkinson's Disease. This gene is intronless. Different polymorphic forms, point mutations, and/or downregulation of this gene are associated with nocturnal asthma, obesity, type 2 diabetes and cardiovascular disease. [provided by RefSeq, Oct 2019]

Forensic Context

A study in human patients with traumatic brain injury demonstrated that the ADRB2 mRNA in salivary extracellular vesicles was significantly upregulated in outpatient concussion clinic patients compared to healthy controls and was higher in these patients than in emergency department patients with acute head trauma, indicating its potential as a diagnostic biomarker for evaluating injury severity [Cheng et al. DOI:10.4103/1673-5374.266924]. In a separate human study of burn injury, gene expression analysis of subcutaneous white adipose tissue found no significant changes in the ADRB2 postburn [Knuth et al. DOI:10.1097/SLA.0000000000005880].