| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCACUGCGAAGCGGCUUCUUCAGAGCACGGGCUGGAACUGGCAGGCACC… | 2013 nt | 0.5057 |
This gene encodes beta-2-adrenergic receptor which is a member of the G protein-coupled receptor superfamily. This receptor is directly associated with one of its ultimate effectors, the class C L-type calcium channel Ca(V)1.2. This receptor-channel complex also contains a G protein, an adenylyl cyclase, cAMP-dependent kinase, and the counterbalancing phosphatase, PP2A. The assembly of the signaling complex provides a mechanism that ensures specific and rapid signaling by this G protein-coupled receptor. This receptor is also a transcription regulator of the alpha-synuclein gene, and together, both genes are believed to be associated with risk of Parkinson's Disease. This gene is intronless. Different polymorphic forms, point mutations, and/or downregulation of this gene are associated with nocturnal asthma, obesity, type 2 diabetes and cardiovascular disease. [provided by RefSeq, Oct 2019]
A study in human patients with traumatic brain injury demonstrated that the ADRB2 mRNA in salivary extracellular vesicles was significantly upregulated in outpatient concussion clinic patients compared to healthy controls and was higher in these patients than in emergency department patients with acute head trauma, indicating its potential as a diagnostic biomarker for evaluating injury severity [Cheng et al. DOI:10.4103/1673-5374.266924]. In a separate human study of burn injury, gene expression analysis of subcutaneous white adipose tissue found no significant changes in the ADRB2 postburn [Knuth et al. DOI:10.1097/SLA.0000000000005880].