| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGCUGCUCCUUGCUAUAGAAGACCUGGGACAGAGGACUGCUGUCUGCCC… | 498 nt | 0.5281 |
Defensins are a family of antimicrobial and cytotoxic peptides thought to be involved in host defense. They are abundant in the granules of neutrophils and also found in the epithelia of mucosal surfaces such as those of the intestine, respiratory tract, urinary tract, and vagina. Members of the defensin family are highly similar in protein sequence and distinguished by a conserved cysteine motif. The protein encoded by this gene, defensin, alpha 1, is found in the microbicidal granules of neutrophils and likely plays a role in phagocyte-mediated host defense. Several alpha defensin genes are clustered on chromosome 8. This gene differs from defensin, alpha 3 by only one amino acid. This gene and the gene encoding defensin, alpha 3 are both subject to copy number variation. [provided by RefSeq, Oct 2014] CIViC Summary for DEFA1 Gene
A study in humans demonstrated that the DEFA1 gene, representing DEFA1, DEFA1B, and DEFA3, was selected from GTEx database screening as a candidate mRNA marker [Lin et al. DOI:10.1016/j.fsigen.2025.103376]. In a separate investigation of human post-mortem tissues from sepsis patients, the DEFA1 gene was found to be upregulated as part of the antimicrobial peptides pathway in the prefrontal cortex, hippocampus, kidneys, and colon [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938].