| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUGUGCUUCCACCACUGCCAAUAACAAAAUAACUAGCAACCAUGAAGU… | 2426 nt | 0.3895 | |
| AUUGUGCUUCCACCACUGCCAAUAACAAAAUAACUAGCAACCAUGAAGU… | 2284 nt | 0.3849 |
This gene encodes alpha-fetoprotein, a major plasma protein produced by the yolk sac and the liver during fetal life. Alpha-fetoprotein expression in adults is often associated with hepatocarcinoma and with teratoma, and has prognostic value for managing advanced gastric cancer. However, hereditary persistance of alpha-fetoprotein may also be found in individuals with no obvious pathology. The protein is thought to be the fetal counterpart of serum albumin, and the alpha-fetoprotein and albumin genes are present in tandem in the same transcriptional orientation on chromosome 4. Alpha-fetoprotein is found in monomeric as well as dimeric and trimeric forms, and binds copper, nickel, fatty acids and bilirubin. The level of alpha-fetoprotein in amniotic fluid is used to measure renal loss of protein to screen for spina bifida and anencephaly. [provided by RefSeq, Oct 2019]
A study in humans demonstrated that the AFP is a protein marker for the identification of neonatal blood, as mentioned in the introductory discussion of the research [Sakurada et al. DOI:10.1016/j.legalmed.2012.01.014].