| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGGCGAGGAGUCCAGAGAGCCAUGGCCGCCCUGCGUGUCCUGCUGUCCU… | 1277 nt | 0.5497 |
The protein encoded by this gene functions in the second step of the mitochondrial fatty acid beta-oxidation pathway. It catalyzes the hydration of 2-trans-enoyl-coenzyme A (CoA) intermediates to L-3-hydroxyacyl-CoAs. The gene product is a member of the hydratase/isomerase superfamily. It localizes to the mitochondrial matrix. Transcript variants utilizing alternative transcription initiation sites have been described in the literature. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that a 7-day overfeeding intervention in lean and obese men induced up-regulation of the ECHS1 gene, which is involved in metabolic processes, in abdominal subcutaneous adipose tissue as part of a broader transcriptomic response to an energy surplus [Shea et al. DOI:10.3945/ajcn.2008.25970].