Basic Information

Symbol
AGR2
RNA class
mRNA
Alias
Anterior Gradient 2, Protein Disulphide Isomerase Family Member HAG-2 AG2 PDIA17 XAG-2 Protein Disulfide Isomerase Family A, Member 17 Secreted Cement Gland Protein XAG-2 Homolog Anterior Gradient Protein 2 Homolog AG-2 HPC8 Anterior Gradient 2 Homolog (Xenopus Laevis) Epididymis Secretory Protein Li 116 Secreted Cement Gland Homolog Anterior Gradient Homolog 2 HEL-S-116 GOB-4 RIFTD
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Wound age identification

MANE select

Transcript ID
NM_006408.4
Sequence length
1697.0 nt
GC content
0.4113

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-434.80 kcal/mol
Thermodynamic ensemble
Free energy: -469.58 kcal/mol
Frequency: 0.0000
Diversity: 529.02
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((((..((((((.(((((..((((((...........))).)))))))).))...))))((((((.....((((....(((.(((((.........(((((((((((..((((((........))..))))...))))))........))))).......)))))...))).))))..........(((((((..((((....)))))))))))...)))))).((((....))))..((((.(((...))).))))....((((((((((((((...((.((((((....))))))...)).(((.((......)).)))........(((((((((((((...........(((.(((((....((.((.(((...))).))))....))))))))...........).)))))).))))))((....((((((........(((((((((((((.((((((((((((((.....(((((.(((((((.......))))......))).)))))(((..........)))..(((((.((.(((....(.((((.(((.((....))))).)))))....))).)).)))))..........(((((((.((((((((((..((.(((((.((..(((((....(((.......(((((((..(((....((((((.....(((((....)))))...(((((((((((((.(((......(((((.(((((((((........)))))))))..)))))...((((((((..(((....)))....))))))))...))).)))))))))))))...................(((((((...((((.((((((.(((...((((((((......((((......))))...)))))))).....((.....)).....))).)))))).))))...)))))))..........(((((.(((..........))).)))))...))))))..))).))))))).......))))))))...)).).)))).))..)))))))..(((..(((.(((((((((........................(((((.((..............((((((((......(((.(((((.(((((((((....(((.......)))......)))))))..)).))))).))).......))))).)))((((((..((....))..))))))..((((((.(((....(((((.((..((((..((....))..))))...)).)))))...)))))))))...)).)))))...(((((((................)))))))))))))))))))..))).......(((..((((((((.((((.(((.........)))....)))).)))))))).))))))...)))))))))))))).....))).)))).))))))))..(((((.((((.....(((((((((..(((((.....))))).........(((((((((((...........................)))))))))))....))))))))))))))))))..)))))......))))))...)).....(((((((((..........)))))))))))))))))))))))............((......)).))))))).....
Thermodynamic Ensemble Prediction
..(((((((,{{(({({.({{{{..||{{{{...........|||,|}||||||,||...||||{{((((...(((({.....}))}{{({{,,,.,,.,,(((((((((((..((((((........))..))))...))))))........))))).,..,.,))}}}...))}.}))}.,}}},..,}|||((({..{{{{,,,,||||||||}}}..,))))}}.||||,,..|}},..,{||,{{,...})}.},,.,{{.((((((((((((((...,,.((((((....)))))),{{{|{({{{((..,,||||{|||,,,.....{((((((((((((...........{({.(((((....((.((.(({...})).))))....)))))}))...........).))))))},))))|((,{..((((({...|||..|{{{{(({{((({,((({{{{{{{(((({,{{{(((((.((((,{,..,,,,.,,,.},,..}))).))))).||}.......,,|||{{,.,{{,|||||{{{{{,,{{{{,{{,.,.,{{.|{|||{|,,}{{{{{|((.{{{,,||..,{{.......|||{,,.||.,|||,}}}}.||||{.}}}}})}))}|,...||}},}.,||{{{{|||,.{|||||,||||||..||.,{{{{..,,))))},{{{((((,{((({,{.{,{......|{{{{.{((((((((........)))))))))..||||}...((((((((,{(((....))},}}.)))))))),,,,,{{|||,,,,|||{{{{{{.......,,,,,....|||||,({{{((((,(({{(({(,.{{((((((((({....((({{..(((({((.....))..))))),,.)}}.....|{{{,.,...}))|}}.|,,,...},,,,,}..,|||....,,|||.|||.}}}))))})))).|||||{..||,,||,...)}),,,.,,.}})))},{{{{{{{...,,.,.}}}|.,,,.,},}..||,|,|.,|,.{((((||,,|}}},..,,,,....}}}}...}}}}}}}.}}}}}}}}}..}}}}|{((((((((...|{||....,)},})))),,))},...|||...{{{{||,...,}}}}...,}}.},}},,.}},.}}}},,,}.{{{{.{((((((((..((....))..)))))),){{{{{{.{{(.,..{{{{{.||..{{{{,.||,...)}..|})),,.||.}}}}}...}})))))))...,}}}))),...(((((((.,..,,....,..,,.))))))),,,,,}},|||||.||,......}|||..((((((((.((({.{{{.........),..,,.)))).)))))))).})))))),})))}},}}))})))..,,,|||||,||{|||||,||..(((((.(((,....,(((((((({..(((((.....))))}....,...{(((((((((((...............,,..........))))))))))))},.})))))))))))))))))..))})).}}}}})})))),,,)),....(((((((((..........)))))))))))))))))))))))}}}......,,,||......,,.,)))))).....

Transcripts

ID Sequence Length GC content
ACUCAGAAGCUUGGACCGCAUCCUAGCCGCCGACUCACACAAGGCAGGU… 1697 nt 0.4113
Summary

This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, a catalytically active thioredoxin domain, and a C-terminal ER-retention sequence. This protein plays a role in cell migration, cellular transformation and metastasis and is as a p53 inhibitor. As an ER-localized molecular chaperone, it plays a role in the folding, trafficking, and assembly of cysteine-rich transmembrane receptors and the cysteine-rich intestinal gylcoprotein mucin. This gene has been implicated in inflammatory bowel disease and cancer progression. [provided by RefSeq, Mar 2017] CIViC Summary for AGR2 Gene

Forensic Context

A study in rats demonstrated that the AGR2 mRNA is significantly upregulated in the hippocampus following cardiac arrest and cardiopulmonary resuscitation, as validated by qRT-PCR [Li et al. DOI:10.1038/s41598-024-75875-3]. The AGR2 is an evolutionary conserved protein disulfide isomerase expressed during scarless wound healing in embryonic mammalian skin but normally inhibited in adults, and its extracellular form accelerates keratinocyte migration and influences collagen deposition [Kosykh et al. DOI:10.3390/ijms24097895].