| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUCAGAAGCUUGGACCGCAUCCUAGCCGCCGACUCACACAAGGCAGGU… | 1697 nt | 0.4113 |
This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, a catalytically active thioredoxin domain, and a C-terminal ER-retention sequence. This protein plays a role in cell migration, cellular transformation and metastasis and is as a p53 inhibitor. As an ER-localized molecular chaperone, it plays a role in the folding, trafficking, and assembly of cysteine-rich transmembrane receptors and the cysteine-rich intestinal gylcoprotein mucin. This gene has been implicated in inflammatory bowel disease and cancer progression. [provided by RefSeq, Mar 2017] CIViC Summary for AGR2 Gene
A study in rats demonstrated that the AGR2 mRNA is significantly upregulated in the hippocampus following cardiac arrest and cardiopulmonary resuscitation, as validated by qRT-PCR [Li et al. DOI:10.1038/s41598-024-75875-3]. The AGR2 is an evolutionary conserved protein disulfide isomerase expressed during scarless wound healing in embryonic mammalian skin but normally inhibited in adults, and its extracellular form accelerates keratinocyte migration and influences collagen deposition [Kosykh et al. DOI:10.3390/ijms24097895].