| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUUUGCGGCAGCGCCGAGAACCCCACCCCCUUUCUUUGCGGAAUCACC… | 1446 nt | 0.5450 |
This gene encodes a subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This subunit contains an N-terminal glutathione transferase domain, which may be involved in regulating the assembly of multisubunit complexes containing this elongation factor and aminoacyl-tRNA synthetases. [provided by RefSeq, Jul 2008]
A study in rats demonstrated that the EEF1G (Eukaryotic translation elongation factor 1 gamma) was identified as a potential regulator of methamphetamine reward and addiction through transcriptome profiling of whisker follicles, showing a down-down regulated expression pattern (0.77 at MASA, 0.33 at WD) and a betweenness centrality score of 0.0197 [Song et al. DOI:10.1038/s41598-018-29772-1].