Basic Information

Symbol
EGR1
RNA class
mRNA
Alias
Early Growth Response 1 NGFI-A AT225 Nerve Growth Factor-Induced Protein A Early Growth Response Protein 1 Transcription Factor ETR103 KROX-24 ZIF-268 ZIF268 G0S30 TIS8 Transcription Factor Zif268 Zinc Finger Protein Krox-24 Zinc Finger Protein 225 Zinc Finger Gene 225 ZNF225 EGR-1 225 KROX24
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses Chronological age estimation Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_001964.3
Sequence length
3137.0 nt
GC content
0.5531

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1037.10 kcal/mol
Thermodynamic ensemble
Free energy: -1091.05 kcal/mol
Frequency: 0.0000
Diversity: 821.97
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((....(((..(((..(((((((.((.((((((....((((((...((.(((.(((((((((((((((((..(((((((.((....((((..((.((.((((.(((....)))))))..))))...))))..)).)))))))...)))))(((((....)))))(((((((.((((((.(((..((((((..(((..(((.(((((.......((((((.((......)))))))).......((((((......((((..((((...(((.(((((...((((........))))((((((((((.(......).))))))..))))......((..(((.....)))..))....(((...)))..............))))).))).....))))..))))..))))))....)))))...))).)))))))))((((....)))).((.((.((....)).)).))....))))))))))))).)))))))))))))))))).))....((.((....)).)).................))))))....)))).)).))))).))))...)))..)))...(((.......))))))))))........(((.(((((.(((.((.(..(((((..................))))).)))))).))))).....((((.......(((((((((((.((.....((((((((..((((((((.((((((((.......(((((((..(((((.(((.(((.(((...........(((((...(((.(((((......(((..(.(((.............))).)...))).......)))))..))).)).))).......(((....)))........((((((((...............))))....))))))).))).))).)))))...)))))))......))))))))..(((..((((((((((.....((((...(((.(((((.......))))))))....)))).((((.(((((((......((((....))))......))))))))))).(((((...))))).......(((((...))))))))))).((.((.....)).))...))))..))).........))).)))))...))))))))..)))))))).))))).......))))))).((((..(((((..(((((((((..........))).(((.((((((((((....((.(((((((((((.((....................)))))))....))).).)).))((((((((((((((..((((....))))......((.......)).........((((((.((.(((((((((((.((....))..))))...(((.(((((((((....................))).....(.((((((((......)))))))).)......(((((.....((.((((....(((.....)))....)))).)).....))))).)))))).)))((((((((.(((((.....((.(..((((((.....))))))..)))..............(((....))))))))...))))....))))..(((....))).....((((((...((((..........((((.(((((((((.(((.(((((((((((.(((.(((((.............((((((((((...((((((.((..........)).))))))...)))).............(((((..((.......))..))))).(((((((.((..(((((((.....(((...(((.(((....))))))...)))..)))))))..(((((((((...((.(((.......)))))...)))))))))...)).))))))).)))).)).............))).))....))).))))))))))).))).))))))...)))))))........)))).))))))(((((...))))).....((((.........))))))))))).)).))))))((((.(((.....((((.((((((((((((((((((.((((((((..(((....((((.......))))...)))(((((((((............)))))))))....((((((((.(((((........))))).)))..........)))))..........((((((((.((.((((((.....((((.(((.....(((((....))))).....))).((((((.(((..(((((((.((((...(((((((....(((.((.(..(((((((.(..((((((((((((((..(((........))))))))))(((......))).(((((..(((((((((((((((((((((((((((.....(((((.......)))))....((.(((((((.(((.....((((.((.........)).))))....))).))))))).))((((.(((.(((((((((((....................)))))).).))))))).))))..(((((......))))))))))))))))))))))))))))))))..))))).............(((((......)))))..)))))))..))))))))....).)).))).....)).)))))..)))))))))))..))))))).)).))))...)))))).)).)))))))))))))))).))).)))))))))).((((....))))....))))).)))).(((((((...)))))))..((((.(((.(((........)))...)))...))))(((((..(((((......)))))..(((((.((((..........)))).))))))))))))).))))((((....)))).))).))))))))))).(((((((((...))))))))).((((......))))..............)))))))))).)))..(((((.......)))))(((..((((((.(((...))).).))))).)))..))))))..))))))))).................................
Thermodynamic Ensemble Prediction
(((((((....(((.,(((..(((((((.((.((((((....((((((,,.((.(((.(((((((((((((((((..(((((((,({....((((..{{.({.((((.(((....)))}))),.)))}...)))),.)},))))}}),.,)))))(((((....)))))(((((((.((((((.(((..((((((..(((,{{,(.(((((.{.....((((((,({......)))))))).......((((((....,,{(((,,((((.,,{{{,((((({.,(({{,.{||...})))(({{((((((.(......}.))))))..)))).,....,,..(((.....)))..,,..|,||,,,.})),,...........}))))),)))..,.,|||}..})))..))))))....)))))...,)).)))))))))((((....)))).((.((.((....)).)).)).}}.))))))))))))).)))))))))))))))))).))....||.((.{{.,,.)).}}..............))))))....)))).)).))))}.))))...)))..))).{,(((.......))),))}}}}........||||{(((({(((,((.{..{((({.....,,........,,.)))))..},}}}.}},},.....((((,,,....(((((((((((.{(.....((((((({..(({{{{(({,{((((((.......(((((((..(((((.{((,(((.(((,.....,....||,....}|||.||||{......,,...({((,.....)))),.,,||,.....}}),......}}),|||||}..|{}},.....}},,|.},}))}........|{{|((((...............))))....}}}},,,.,}}.))).)))))...)))))))......))))))|((((((..,({({...,,.....||,|.,,)}|.,||||}}}},,.}|||||||,{{((({,.((((.(((((((...,..((((....}))).,}...))))))))))),||||{...))}}}.,,{|,.(((((...)))))}|||||.||,|{.....}}.||}},,},,......,,,}},,......}))),..})))))))..)))))))))}}}))....,..)))),,,.{{{{..((({{..{(((({{{{..........}||.(((.((((((((((.,,,...(({,,{((({(.{(,............|......})))}))...,))).),},.},((((((((((((((..((((....))))......,,.,,,,,,{|.{{{.....((((((.((.(((((((,(({,((({....}})))),.|{((.((((((({(....................|}}.....(.((((((((......)))))))).)......(((({.....((.((((....(((.....)))....)))).)).....))))).)))))).))}((((,(({,((,(((....{(.(..((((((.....))))))..)}}...},}}},.,,..,,{,...|||,.||.......,....},...,||{....}}}.....((((((...((((..........((((.(((((((((.(((.(((((((((((.(((.((,{{...,..,......,,,,,,((((...((((((.((..........)).))))))...))))..,{((.((((({(((((..{(,,.....))..))))).(((((((.,,..(((((((.....(((...(((.(((....))))))...)))..)))))))..((({{{{{{...{|.(((.......)))}}..,)))))})))}},}).,}))))}.,))),)}.............))).,,....))).))))))))))).))).))))))...))}))))........)))).))))))(((((...)))))....,{{{{,........))))))))))).)).)))))).....(((((..(((((.{....(((((((((((((.(((((((,..{,,,{{{({{{.,,,,,.}}}|{{{||,(((((((((............)))))))))....|}||||{{.,((((........,}}}}.}},...,,,,|,,.,},,.,},.....{((((((((.{(.((((((.....{{({.{{{.....((({(,.,,|}}}),,.|||}}.{{((((.(((..(((((((,((((...((((({(....(((.{{.{..(((((((.(..(((((((((((((,.{(((........))))))))),(((...{{,,,,.(((((..(((((((((((((((((((((((((((..,{{...||,...,,.,||||,,|{((.(((((((.(((.....({{{.{{.........))}}})),,..))).)))))}}.}}{(((,(((,(((((((((((,......,,,...,..,,..}))))),)}))))})),)))}..{{{||......))))))))))))))))))))))))))))))))..))))).....,}}...,}|{(({......))))}.})))))))..))))))))..,.,.}).))).....)}.)))))..)))))))))))..))))))).)}.))))...)))))).)}.)))))))))))))))).)))}})))))))))....})).)))....))))).(((((((((((...)),}))))))))((((.(((.(((........)))...)))...)))).,{{...,,{{|.....,|||,...{((({.{(((..........}))).))))))))})))},))).((((....)))).))).))))))))))}.{((((((({...})))))))}..{{,.....,)))},........,,...)))))))))).)))...,{{|.,|||..|}||||||...|||||,|,,...|||.|{,.,,,.)),},)))))}..))))))))}..,.,,...........................

Transcripts

ID Sequence Length GC content
GAGAGAUCCCAGCGCGCAGAACUUGGGGAGCCGCCGCCGCCAUCCGCCG… 3137 nt 0.5531
Summary

The protein encoded by this gene belongs to the EGR family of C2H2-type zinc-finger proteins. It is a nuclear protein and functions as a transcriptional regulator. The products of target genes it activates are required for differentitation and mitogenesis. Studies suggest this is a cancer suppressor gene. [provided by RefSeq, Dec 2014]

Forensic Context

A study in humans demonstrated that the EGR1 is downregulated in the dorsolateral prefrontal cortex of individuals with Opioid Use Disorder, where it regulates angiogenesis via modulation of pro-angiogenic FGF2 signaling [Mendez et al. DOI:10.1038/s41380-021-01259-y]. Separately, research in human peripheral blood identified the EGR1 as a differentially expressed gene exhibiting a consistent expression trend from young adulthood to later life, and it was incorporated into a validated age prediction model using machine learning algorithms [Liao et al. DOI:10.1016/J.Fsigen.2025.103373]. A study in humans demonstrated that the EGR1 was significantly upregulated in pericontusional brain tissue from patients free of alcohol following traumatic brain injury [Michael et al. DOI:10.1016/j.jocn.2004.11.003].