Basic Information

Symbol
ERCC2
RNA class
mRNA
Alias
ERCC Excision Repair 2, TFIIH Core Complex Helicase Subunit EM9 XPD Excision Repair Cross-Complementing Rodent Repair Deficiency, Complementation Group 2 General Transcription And DNA Repair Factor IIH Helicase Subunit XPD TFIIH Basal Transcription Factor Complex 80 KDa Subunit Xeroderma Pigmentosum Group D-Complementing Protein Excision Repair Cross-Complementation Group 2 Xeroderma Pigmentosum Complementary Group D DNA Repair Protein Complementing XP-D Cells Basic Transcription Factor 2 80 KDa Subunit DNA Excision Repair Protein ERCC-2 DNA 5'-3' Helicase XPD TFIIH 80 KDa Subunit TFIIH Subunit XPD MGC102762 MGC126218 MGC126219 TFIIH P80 BTF2 P80 CXPD MAG Excision Repair Cross-Complementing Rodent Repair Deficiency, Complementation Group 2 Protein TFIIH Basal Transcription Factor Complex Helicase XPB Subunit TFIIH Basal Transcription Factor Complex Helicase XPD Subunit EC 5.6.2.3 EC 3.6.1 COFS2 TFIIH TTD1 XPDC TTD
Location (GRCh38)
19:45349773-45370918
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Mechanical injury analysis
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_000400.4
Sequence length
4108.0 nt
GC content
0.6000

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1701.50 kcal/mol
Thermodynamic ensemble
Free energy: -1769.32 kcal/mol
Frequency: 0.0000
Diversity: 1111.18
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((.....)))((.((((((.(.(((....))).(((.(((((..((((.(.((((((((((....(((((((.((((....(((..(((((((((..........(((((((((((.........(((((.((((((((((......((((((...((((....)))))))))).(((((.....))))))))))).....)))).).))))(((((...(((..(((......)))...(((..((((.(((((...(((...)))...)))))..))))..))).((((..(....)..))))..(((((...)))))((((((((((......)))).)))))))))...)))))))))))))))).......(((...(((((....))))))))..))))...)))))..))).)))))))))))..))))...((((..(((((......(((((((.((((.((.....((((((((.((((....((......((((.((((.((((.(((((....))))).))))(((((...((...((((((((.....)))))).))....))....)))))(((((((....)))))))..........(((..(((.....)))..))).......(((((((((...)))))))))..)))).)))).....))...))))..))))))))...)).)))))))))))(((((.....)))))..((((((((((................(((((.(..((((((.((((((...(((...((((((........))))))(((((....)))))....(((((((..(.((.(((((....((.....)).....))))).))))))))))..)))....)))).)).))))))..).)))))(((((((..((((((((((((((((..(((.....))).....)))).)).)))).((((((((.(((((((((..((((((.((((((((....((((((((...(((.((((((((((..((.(((((((.(.(((((..(((....))))))))).))))).)).)).))))).)))))((((((((.(((.((.(((..(((...((((.(((((.....))))).))...(((((((((((((((.........(((((((............((((((((.((....)).)))..))))).((((((.((((((((((..((((((.(((((((((.(((....((.((((((.(((............))).)))))).))..........((((((.(((....((((.(.((......)).).))))..(((.....)))..(((((......)))))........((((((((.....((((...(((((...))))).((.((((((((...(((......)))....(((((..(((((((((((..........((((((..((((.(((....))).))))...)).))))..)))))))...))))..))))).......(((.......)))..((((.((((..((.(((((.........))))).))..)))).))))))))))))))))))((((((((((((..(((((((((((......(((.(((.....)))..)))..((((((((((((((((((((((..(.(((((..((...))..))))).)...))))))...........(((((.((((((........)))))).)))))....))))))))))))).))))))).)))))))((((((..(((....))))))))).(((((...)))))..((((((((.(((((((.......(((((.(((.(((((.......))))).))))).))).....))))))).)).))))))..((((((((((((((.((....))....)))))).....(((((((.....))))))).......)))..)))))...(((((((.....))))))).))))))))))))..))))))))..)))...))))))..))).)))))).))).(((((.((((..((.((((((.......))))))))..)))))).)))......(((.((((.(((((((((((.(((((((((((((.((((((.(((((.((......(((((.((((((((.((.((((((...))))))....((.((((..(((...((.(((..(((((((((.((..(((((((((((.(.....(((((((((((((..((((((.....))))))(((.....(((((........(((.(((((((((((.((((((((((((.(((((((...)))).))).).))).....)))).)))).).))))..((((((........)))))).......((((((..((....))))))))........)))))).))).((((((.((((((((...(((..(((((...((((((.(.((((.((((((.((((((..(((.(((((.(((...(((((((.....)))))))(((((.....)))))(((((....)))))....(((((((((((((((((...))))))..))..)))))))))........))).))))))))..)))))))))))).))))..).))))))....)))))..))).)).....(((((((((...)))))).)))...........)))))).)))))).))))).......)))...)))))).)))))))).)))))))))))..............)))))).)))))...)))))..))).)))).)))).))))..))))))))).......)).))))).)))........(((.(((.((.......)).))).)))...)))))))))).....)))))).))))...)))))).)...))))))).........)))))).....))))))))))...))))))......((((.((...))))))...)))))))....)))))))))))))))...(((.....)))((((((((((.(.((((.((..(((((((..........((((((((.((((((((((((.(((...((((....).)))(((.....)))(((.(((.((.((.((.(((((((.(((((...(((.(.(((((..(((((.((....)).)))))((((((((...(((((.....))).)).....))).)))))((....))))))).))))...))))).))))))))))).)).))))))..)))))))))......)))))).)))))))))))))))..((((((.((((((.(((..((((((.((((.((..((((((((.......))))))..))..))...)))).)))))).)))))))))(((((.(.((.((((.((((((((....((....(((((((((((.((...((((((((((((...(((((((....)))))))(((((((((...(((..(((((((..((((.......)))).))))).))..)))...))))))))).(.(((((.((((((((....((...))))))))))))))).).......))))))))))))............(((((...(((((.((((...)))).))))).))))))).)))))))))))...)).))))))))...)))).)).)...)))))(((((((...(((((......))))).))))))).........))))))..))))))).))))..)))))))).....)))..))))).))).)).))))))..)))))))))))......((......))))))))))..))))))))))))))).....(((......)))))))))))....)))))).))))))))).))))).)))(((((((((((...(((((((....))).))))((.((((.....)))).)).....))).))))))))..)))))..)))))))))).)))))..))))))))......).))).))).))..
Thermodynamic Ensemble Prediction
(((.....)))((.((((((.{.(((....))).((,{(((((..((((.(.(((((({{{{,...(((((((.((((....(((.{((,((((,(,.......,.(((((((((((.........((((,.((((,{(((({.{{.{{(((((.,.((({.,,,)))}))|||,.(((((.....))))),,))))}}}}.)))).}.)))),((((...{((,|.|,{{(({{||...,||||||.{{||{(({...{||.,,|}},,,}))}}..))),.}}},.((((..(....)..))))..(((((...)))))(((({{((({......}))).)))))))))...)))))))))))))))).......{{(,..{((((....)))))}}}..,,}}}}}),))).,)),.))))))))))),{||||,,(((({((({{......,,||{||||.{{((.{{,,{,,(.((((((((((((({{..{{{...{{,.,,(((...,,((((({.,{(((,{.((((,,,,}|}}}|}},.||||||,,...,,)}}}}).}}....)))..})))))||||||,||||}}}}))}}.....,,{,(({..(((,,.,.}}},{|||..,....((((((((,...,}}}))))),,},{{.{||,..|||.|,.}}}}}...}))})))}},)),}}}||||}}}|,((((.{{((,{,,,,}.})))))))........,},,...|||||||,||,||||}||{|||},..}}}},..((((((........))))))(((((....)))))....,,(((((.{({(({,(((({({{,{............,.|{{{{|{|||||||,{{,|||,.||})}}}|}}}|,}{{|{||{(((.((({{{.|||{||||.,...}}}.})}},..))))))..,})}))|||})))}.||..|}||}||(((((((..((((((.((((((((,{{.((((((((..,(((,{((((((((({{(,{((((((({({((((({..(,{{{,|||||,,,,})))),.||,||,||||||.||},|||{||{|,|||}.|)|}|,.,}}}}..}||}|||||.}}}}))},,,))}}}||||{{{((((((({...{.,,,,{{(((((,,{.,,,...,,{(((({{(,(,.,,.||,|}},.|||||,((((((.((((((((((.....{((,(((((((((.(((....((.(((((((((,............))),)))))).))...,......((((((.(((....{{,({({(({.....},})})}))}.(((.....)))..,{{{,...,..,}})}},},....((((((((.....{{{,...(((((...))))).((.((((((((..,{{{,,.,,{|{{,...(((((..(((((((((((........,,((({{{..((((.(((....))).))))...}}.}}}}.})))))))...))))..))))).,..,||{{{,.....,)}}..{(((,{(({..{{.{{{{|.,...,..,)}))),}}..})}}.}})))))))))))}})}}((((((((((((..(((((((((((......(((.(((.....)))..)))..((((((((((((((((((((((..{.(((((..({...))..))))).}...))))))...........(((((.((((((.,....}.))}))).)))))....))))))))))))).))))))).)))))))((((((,.(((....))))))))).(((((...}))))..((((((((.(((((((.......{{({(.(((.(((((.......))))).))))}.})}.....))))))).)).))))))..((((((((((((((.((....))....))))))}....(((((((.....)))))))..,,...))}..))))).,.(((((((.....))))))).))))))))))))..))))))))..)))...))))))..))).)))))).))).((({(.((((..(,{((((((.......))))))))..))))}).)))......{{{.((((.(((((((((((.(((((((((((((.((((((.(((((.((......(((((.((((((((.{(.((((((...))))))....((.((((..(((...((,(((..(((((((((.,(..(((((((((((.(.....(((((((((((((..((((((.....)))))){(({.,{{(((((........(((.(((((((((((,(((({(((((((.(((((((...)))).))).).))),....}))).)))).),,))}{.((((((........)))))).,.....((((((..((....)))))))).......})))))).))).((((((.((((((((...(((..(((((...((((((,(.((((.(((({((((((((..(((.((((({(((...{((((((.....))))))}((((({...,))))){{{((,.,.))))),,..(((((((((((((((((...))))))}...,,))))))))),}},,..,}}}.})))))))..)))))))))))).)))).,).))))))....)))))..))).})}.,,.(((((((((...)))))).)))...........)))))).)))))).))))}.......)))...))))))},))))))).)))))))))))..............,,)))).)))))...)))))..))).)))).))}}.))))..))))))))).......)).))))).)))........(((.(((.((.......)).))).)))...)))))))))).....)))))).))))...)))))).)...))))}||{{......,,..}))))))}))))))))))...))))))......((((.((...|||||,..})))),)).,}})}}||||}|}}}},,,|||||,,...}}}}))}}}}|.},|}|||,.}}..)))))}}.,|,,,|.,,,{|{|||||{{(((((((((.((((...((((,,.,,{({((((,,,,,|||{..,|||.,,.,.,((.(((((({,(,{{{,,,(({{{.{{||,.,|||||}||}.,.,|(((..(((((((((...(((((.....))).)).....)))}})))))..)))))))))}})))))}}))})}(((((((((({........))))))..)))))..))))...)))))))))))))}|||||||.||||||,((((({{(((..((((((.((((.((..((((((((.,...,.))))))..})..))...)))).)))))).))))))))).{{{{.{.({.((((.((((((((,..{(,....(((((((((((.(({..((((((((((((..{(((((((....))))))}|((((((((..{(,{,,(.((({{,{((,((.......)}.})))}}}))}.))))}.))))))))},(.(((((.((((((((....{{...}}))))))))))))).)..,}...))))))))))))............,{(((...(((((.((({...}))).))))).)))}))).)))))))))))..,)}.))))))))...)))).)).,...|}},|(((((((...(((((......))))).)))))))},.......})))))...,,}))|.,.}}|,,}}}||||||...||}.,))|||,||||||,||||||..}}},,})))))..,,..,|,},,,})}))))))))..)))))))))))))),}}}})))))))))}}))))},,.,)))))))))))))}|(({(,,,{(({{.({{.,(((((((((...(((((((....)))))}}}((.{(((.....)))}.}}...,.))).))))))))).)))),..)))))))))).)))))..)))))))}......).))).))).))..

Transcripts

ID Sequence Length GC content
NM_000400.4 NCBI
GGGUCGACCCCGCUGCACAGUCCGGCCGGCGCCAUGAAGCUCAACGUGG… 4108 nt 0.6000
NM_001130867.2 NCBI
GGGUCGACCCCGCUGCACAGUCCGGCCGGCGCCAUGAAGUGAGAAGGGG… 1704 nt 0.6197
Summary

The nucleotide excision repair pathway is a mechanism to repair damage to DNA. The protein encoded by this gene is involved in transcription-coupled nucleotide excision repair and is an integral member of the basal transcription factor BTF2/TFIIH complex. The gene product has ATP-dependent DNA helicase activity and belongs to the RAD3/XPD subfamily of helicases. Defects in this gene can result in three different disorders, the cancer-prone syndrome xeroderma pigmentosum complementation group D, trichothiodystrophy, and Cockayne syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008] CIViC Summary for ERCC2 Gene ERCC2 functions as a DNA repair gene involved in separating the double helix via 5’-3’ helicase activity. It forms a part of the transcription factor II Human (TFIIH) complex and is ATP-dependent. The TFIIH complex is known to be involved in the nucleotide excision repair pathway (NER) which can repair DNA damage caused by chemotherapeutic treatment and basal transcription. ERCC2 variants have been observed in a variety of cancers. A number of studies have suggested ERCC2 variants can act as biomarkers to predict response to neoadjuvant treatment, and cancer prognosis. Additionally the Lys751Gln polymorphism has been observed to increase risk in a number of cancer types; however, results have been conflicting.

Forensic Context

A study in rats using an organotypic hippocampal slice model of traumatic brain injury demonstrated that the ERCC2 is implicated in axon regeneration blockade following severe (50% stretch) injury, as it was upregulated and mentioned in the introduction and discussion of the research [Di Pietro et al. DOI:10.1089/neu.2009.1095].