Basic Information

Symbol
ERCC5
RNA class
mRNA
Alias
ERCC Excision Repair 5, Endonuclease ERCM2 XPGC Excision Repair Cross-Complementing Rodent Repair Deficiency, Complementation Group 5 Xeroderma Pigmentosum, Complementation Group G Excision Repair Cross-Complementation Group 5 DNA Repair Protein Complementing XP-G Cells DNA Excision Repair Protein ERCC-5 XPG Xeroderma Pigmentosum Group G-Complementing Protein XPG-Complementing Protein Cockayne Syndrome EC 3.1.-.- ERCC5-201 COFS3 UVDR
Location (GRCh38)
Forensic tag(s)
Chronological age estimation Other applications

MANE select

Transcript ID
NM_000123.4
Sequence length
3888.0 nt
GC content
0.4570

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1150.40 kcal/mol
Thermodynamic ensemble
Free energy: -1225.12 kcal/mol
Frequency: 0.0000
Diversity: 1010.77
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((.(((.(((((.....(((((((((((((((((.(((..(((...))).))).))))))).))....((((((.(....((((.((....))))))...).)))))).(((((((((((...((.(((((.(.((((((....))))))..).))))).))((((((((.((((..............(((((.((...........)).)))))..))))))).))))).(((((.(((((..(((((((..(((.((((..((((((.((((..((......)))))).))))))((..((((...))))..))((((....))))...((((...)))))))))))...))))))).))))).)))))(((..((....))...)))(((((((((..((((((((((((..((((((...((((.............(((.((....(((((.(((((((((((...))).))))))))...)))))....)))))))))...))))))...((((.....)))).....(((..(........).)))..(((((((((..((.((((((............)))))).))..)))))))))......)))))))).........................((((........)))).((((((.(.((((((...)))))).).)))))).......)))).))))))))).)))).)))))))((((((((...((.................))...))))))))....((((((.((............)).))))))..)))))))))))))))).))))....(((((...(((((...............(((.(((((((((((....(((((((..((((((.(((.((((((((....))))))))..(((....)))....)))))))))........((((.((......)).))))..(((.(((....))).)))..(((((....(((.(((....))))))....)).))).......(((((((((((...((((((((.(((.(((((...((.(((((((..((((((.......(((((.....)))))......((..........)).))))))..))))))).)).)))))(((((((..(((((.(((.((((((.(((((((.....))).(((((.((((..((.(((((((.((.((..((((((....((((.((((((((.......(((((.((((((.......(((..(((((....)))))..)))......))))))))))).......))))).)))...((((.(((......))).)))).))))....))))))...((((...((((.(((((((..(.((((((....)))))).).)))..)))).......((((.(((((((.((((..(((....((((((((((((.(((.......)))((((((.((..((((((((...((((((((((.......((((..((((((.....((....)).......((..((..(((((((((((.(((..(((((.(((((((((.((....((.((((.......((((((.((........((((((((....((((((.......)))))).....)))))))).))))))))....)))).)).((((........)))).........))))).)))))).)))))))).))).........))))))))..)).))((((........)))).(((....)))))))))..)))).......)))(((.(((.....))).)))((((((...((((((.((((((((((((((.(((((.(......).))))))))).))))((((.((........)).)).))...................(((((((((....(((((.(((((.((((..(((............))).....((((((((((..(((((.((((((...((((....(.((.(((.((((.(((((....)))))..))))..((((((.....))).)))))).)).)))))...))))))..(((((((.(((((((((((((((.......))))....))))))))))).))(((((..((.(((((((...(((((((((((((..((((...)))).))))))).....))))))...))).)))).))....)))))...(((((((.......)))....))))..))))).(((.((.((.((((......)))).)).)))))....)))))..))))))).))))))).)))).).).))))((((.(((((...((((((((((..((.(((((..(((((.(((((..((((......))))....))))))))))..........(((((....)))))(((....(((......)))...))).......((((((...........)))))).(((((....)))))..((((((((....))))))))..))))).)).)))))).)))).........))))))))))))))))))(((((...)))))...(((((.((((....))))...)))))....(((((((....))))))).....))))))..))))))))))))((((((((...(((((....)))))....))))))))............(((((....)))))))).))))...))))....(((((((((((.....)))))))))))...))))..)).))))))....((....))....((((((((((...(((((..((.(((((.....))))).))..))).......(((.....)))........(((...(((((.(((((...........(((....)))............))))).)))))...)))............))....)))))))))).))))))))))))...(((((((.(((((((..(((((.(......).)))))....)))...((((((.(((((.....)))))...))))))(((((((((....)))))))))...))))...))))))).((((...((.((((((......))))))))))))......)))..)).)).))))))).))))...))))...))))))))))))))).))..))))...)))))......(((((...(.((((((((((((((..((.......(((((..........((......))........)))))..(((....(((((((.....)))))))....)))....))..)))).))).))))))).)......((......))........)))))........((((...((((((...((((((..........))))))...)))))).))))..)))).)))))).))).)))))))))))))))))))))))((((....))))....((((((....))))))(((((..((((.(((((...........))))).))))..(((((((.(((((........).))))....)))))))...)))))..)))))))))))........(((((.(((........))).)))))..))))))).......(((.((..(.(((.........))).)..)).)))..))))))))))))))..............)))))))))).((((((......(((....)))................))))))............(((.((((((.(((((..(((((((.....)))).)))...))).)).))))))...)))
Thermodynamic Ensemble Prediction
{(((,(((.(((((.....(((((((((,(((((((.(((..(((...))).))).))))))),}}....{|||||.|,,.,{{({.(|....}||}}},..|.}}}}},.{((((((((((,,,((.(((((.(.((((((....))))))..).))))).))|(((({{{.{(((,{{,,....,...,(((((,({.,{{,,.,||,||.|}}}}..))))}|||}}))|,(((((.(((((..(((((((..{((.((({||((((((,{(({|{{{......))))}).}))))){(..(({,...|))}.{||{{{.....}}||...((({...}))))))))))...))))))).))))).)))))(({..{{....}}...}))(((((((((,.{{,(((((((((..((((((...((((,............{((.((.,..(((((.(((((((((((...))).))))))))...)))))..,.)))))))))...))))))...((((.....)))).....(((..{.....,..,.)))..(((((((((..((.((((((...,........)))))).))..)))))))))......))))))))}.......,|{,,.,....},..,.((((........)))).((((((.{.((((({...}))))).).))))))........,,),))))))))).}}}},}))))}}((((((((...((.................)}...))))))))....((((((.((..,.....,,,.)).)))))),||}))}}))}}}}|||},}}}}....,{,{{...(({({.{,,,,..,.,,,,.|||.(((((((((((....,.,,.{{{.((((((.(((.((({{(((,,.,||}}}})),,||,....})),...))))))))).,}.....(((({({......}}.}}}}..(((.(((....))).)))..{{{{{..,.(((.(((....)))))).,..}}.)),...,...(((((((((((...{(((((((.(((.((((({(.((.(((((((..((((((.......,{(((,,...,,},}..,,,||{,......,},,..))))))..))))))).)}))))))|((((((,.,((((.(((.(((((({(((((((.....)))}(((((.((((..{{.(((((((.{(.{{..((((((...,((((.{(((((((,,,....(((((.((((((...,...({{,.({|||,,,.)))))|||})..,.,.))))))))))},......}}}||,|||...((({.{{{..,,..))),)))).)))).,..))))))...{(((...(((({((((({{..,.((((((....}))))).,.)),.,)))).,.....((((.(((((((.((({.,(((....((((((((((((.(((.......)))((((({.{{.,((({{{{{,..{{(({(({{,{,.,,..{{((,.((((((,....{{....))}))}.,|{{..{{,,{({(((({(((.({(..{((((.(((((((((.(({,{{((.((((..,,.,,((((((.((,,...,..((((((((....((((((.......)))))).....)))))))).}))))))}.,,.)))).}}.((((,,......}}}}........,)}))).)))))).)))))}}}.}}},,,......)))))))).,)),}){(((........)))}.{{{,,,,}|||}}}}},,}}}|{{....{{{{(,,..,..}}}})...,}|{{((((...((((((.(({(((((({((((.(((((.(......).))))))))).}|||{{{{.{{..,,....}}.}}.))},,,...,},.........{((((((((.,,|,{{{{.{({{(,({{(,,(({..........,.)}}.....{|{{{{{||||||||||,|{{(((...((((...,(,({,(({,,{{{.(((((....))))).,}}...,((((((.....)))},)))}}.|}.}}}})...})))))..(((((((.(((((((((((((((.......)))),...})))))))))).}}(((((..((.(((((((...(((((((((((({,.{((,...|}},.}}|,}}}}}}..})))))...))),,))).))....)))))...{{((((({,,....}}}....}}|}..}}}}}.((,,({.((.((((......)))).)).}))))....))))}})))))))},.}})))).}))),}|,|,|||((((.({{{{...((((((((((..((.(((((,.{((((.(((((..((((......))))....)))))))))},,,..,}}|,((({(....))))){({....{{{......)))...))).......((((((.........,.)))))).(((((....)))))..((((((((....)))))))),,)}))).)).)))))).))))...,,,,,,}))))))}}}}}}})))}(((((...))))).||(|(((.((({....})))...)))))|...(((((((....))))))).})}})}}))))}})))))}))))}|(((((,{{(((({(({....}))).})))))))))},,,,,.....,,|||||.,,,)))},,}}.,}}},,,}}))...,(((((((((((.....)))))))))))..,}))}..)}.})))))....((....))....((((((((((...((({(..((.(((((.....))))),)},,|||...},},(({.....))).......,{||...(((((.(((((.{.........{{{....}}}..........,.))))).)))))..,|||........,,,}))....}))))))))).))))))))))))...(((((((.((((({{..(((((.{......}.)))))....}}},.{((..(({(({,...,}})))..))),,,}},(((((((((....)))))))))..}))))...))))))).((((...({(((((((......))))))))))))......))).,)).}).))))))).))))...))))...))))))}}))))))).}}..))))...)))))......{((({...,.{(((((((((((((..((.......(((((..,.{,,.{,((................)))))..||||},.,{{{{{{|..,}))))))).|,.}}}....}}..)))).))).))))))}.}}},...((......))........||,}}........((((...((((((...((((((..........))))))...)))))).)))),,})}..}))))).))).)))))))))))}))))))))))|((((....))))}.{.((((((....)))))),|,,,..((((.(((((..,,......,}))))}))))..(((((((.(((((........).))}}}...)))))))...}},))..))))))))))).,......{((((.(((........))).))))).,.,},}}..}.}}.,{((,{{....{{{.......},))).}..}).)}}..})))))))))),,,........,..,,||||,,,||}}|(((({,......(((....)))..............,.)))))),,..,}}}}}..||{.((((({.(((((..{{{((((.....)))).}}}...)))},).)))))).,,)),

Transcripts

ID Sequence Length GC content
CUUCCGGGAGGCGGUGACAGCUGCUGAGACGUGUUGCAGCCAGAGUCUC… 3888 nt 0.4570
Summary

This gene encodes a single-strand specific DNA endonuclease that makes the 3' incision in DNA excision repair following UV-induced damage. The protein may also function in other cellular processes, including RNA polymerase II transcription, and transcription-coupled DNA repair. Mutations in this gene cause xeroderma pigmentosum complementation group G (XP-G), which is also referred to as xeroderma pigmentosum VII (XP7), a skin disorder characterized by hypersensitivity to UV light and increased susceptibility for skin cancer development following UV exposure. Some patients also develop Cockayne syndrome, which is characterized by severe growth defects, cognitive disability, and cachexia. Read-through transcription exists between this gene and the neighboring upstream BIVM (basic, immunoglobulin-like variable motif containing) gene. [provided by RefSeq, Feb 2011] CIViC Summary for ERCC5 Gene

Forensic Context

A study in a Chinese Han population demonstrated that the ERCC5 level in peripheral blood, quantified via SYBR qPCR, declined with individual age with a strong negative correlation (r = -0.8), enabling the establishment of an age estimation model (Y = -31.352X + 14.436 ± 10.28) with an accuracy of approximately 73.33% and a mean absolute difference of 8.22 years [Deng et al. DOI:10.1016/j.legalmed.2021.101912]. In a separate study in C57BL mice, microarray analysis identified the ERCC5 as one of several DNA repair genes previously reported to be upregulated in radiation-resistant cell lines, though its specific expression change was not measured in this irradiation experiment [Dai et al. DOI:10.1080/09553000600857389].