Basic Information

Symbol
ERVW-1
RNA class
mRNA
Alias
Endogenous Retrovirus Group W Member 1, Envelope HERV-7q Envelope Protein HERV-W-ENV Syncytin-1 HERV-7q Enverin ERVWE1 HERVW EnvW Endogenous Retroviral Family W, Env(C7), Member 1 HERV-W_7q21.2 Provirus Ancestral Env Polyprotein Endogenous Retrovirus Group W, Member 1 Endogenous Retrovirus Group W Member 1 HERV-Tryptophan Envelope Protein Envelope Polyprotein GPr73 HERV-W Env Glycoprotein HERV-W Envelope Protein Envelope Glycoprotein Syncytin HERV-W Human Endogenous Retrovirus W EnvC7-1 Envelope Protein HERV-W{7q21.1} Provirus Ancestral Env Polyprotein Envelope Protein HERVWENV HERV7Q Env-W ENV
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_001130925.2
Sequence length
2794.0 nt
GC content
0.4807

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-804.10 kcal/mol
Thermodynamic ensemble
Free energy: -851.62 kcal/mol
Frequency: 0.0000
Diversity: 465.10
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((((.(...(((......)))...)...))).)))))............................((((..((((.......((((..(((((((...((..((.(.(((((....)))))))).))..(((.((.((((((.......))))))..)).).))......((((....))))(((((.((((((((((((.(........)))))).)))))))...((((((.((((.(((......(((..(((..((((((((.(((((.....)))(((((((((((.....)))).)))).)))....((((((((.((((((((.(((((((...))))).....)).)))))))).............(((((((.(((((((.....)))))))..)).))))).)))).))))))))).)))))...)))..))).)))..)))).))))))(((((.(((...))).)))))....(((......)))((((((((((((((((((((((((((((.((((((((...((......))....)))))))).)))....)))).(((((.((((((((((((((((...(((........))))))))))))))).)))).)))))((((((.(((....)))))...))))(((((((((((((.....((((......)))).......((..((...((((.((......)).))))...))))..(((.((((((((((.....((((((......................(((((((((....(((.(((.((((((((((..(((.((((..................(((.((((((((((..(.((((((((..(((..(((((..........)))))....)))...)))))))).)..)))......((((...))))((((((.(((........(((....)))......................(((...)))))).)))).))..........((((((....))))))...........((((((......((((...(((.((((.((...)).)))).)))))))))))))(((((((.((((...........)))).)))))))))))))).)))..)))).)))..)))))))))).)))))).(((.....)))............)))).)))))....(((((((........)).)))))....(((........)))...............((((((((((((.((((((.................))))))...((((((...((........((((((((....((((..((......(((((...))))).....(((((..((..((((..(((((............))))).))))..))))))).))..))))..)))))))).....(((((((((...)))))))))))...)))))).........((((((.....(((.....)))..))))))...............))))))))))))..)))))).......((((.(((..((((..((((((......)).)))).))))...))).)))).)))))))))).)))...((((.(((((.((((..(((..((((((...(((..((((((((..((......))...((((....(((....)))...))))..((...)).....((((((....))))))......)))))))).)))))))))..))).))))))))).))))..))))))))))).)).((((.....((((((................))))))....)))).........)))))((((..(((..((((....(((.(((((............(((((((((((((.((((......)))).)))....)).))))....)))).((((((((((.((((........)))).((((....(((((.(((((((..((.(((((((.((...(((.....)))....))..)))).))).))....)))))))))))).....))))........(((.((.(((((.(((.........))).))))))).)))))))))))))((((....((((((........)))))).)))).(((((((..((((((((....((((.......(((((..(((...)))..))))).((((....))))...))))...))))))))))))))).....)))))...)))))))...))).)))).(((.(((((.((...(((((((...))))))).(((....)))(((.((((((((.((((((..(...((((.(....(((((.(((((((((((((.(((.(((.((((...))))...)))...))).)).........))))))))))).)))))....)))))...)..).))))))))))))))))((.....))..((((..(((...)))))))(((((........))))).......))))))).))).))).))))))..((((....))))))))))).......((((..(((((((((((.....(((.........))).....))).)))))))).))))..))))))))))))..))))((((.....(((((((.......((((....)))).......)))))))....))))...((((((((((...))))))))))....................))))..))))
Thermodynamic Ensemble Prediction
,((((({((,,...(((......)))...}...))).))))),...........................{(((..((((.......{{,...,({{.....(((((((((.(((((....)))))..((((..{.((((((({{((.......||||,...{{,({,{,.,,(,{.,,...,))}},..||,((((((((((((.{,....,..,))))).)))))))...((((((.((({.,|(|.....(((..(((.,((((((((,((.,,...}}||((((((((((((,,...||||,|}}}.}}},...|((((({{,(((({{{{.,{|||{|,,,))))),,,..},,)))))}},.............(((((((.(((((((.....)))))))..)).))))).)))).)))))}))).))))),},)))..))).))}..}))).))))))||||,.(({...})).,||||,...},}},...{{||((((((((((((((((((((((((((((.((((((((...((......))....)))))))).)),...})))).(((((.((((((((((((((((...(((.,....,.))))))))))))))).)))).)))))((((,{.(({....)))}}...)))){((((((((((((.{...((((......)))).......{{..((...((((.((......)).))))...))}}..(((.((((((((((.....((((((......................{{{{({{{{....(({.(((.((((((((((..(((.((((..................(((.((((((((((..{.((((((((..(((..(((((..........)))))....)))...)))))))).}..))).....,((((...))))||||{({{{{..,,,,,.(((....))}........,{,...........||{...||}...||.........},.....{(((({....}))))}...........((((((......((((...(((.((((.((...)).)))).))))))))))))}(((((((.((((...........)))).)))))))))))))).)))..)))).)))..)))))))))).)))}}}.,|,,{....,.............||||,|}}||....((((({(,.......)).)))))....{{{........})}........}}},,,.((((((((((((.{(({{{.................}))))}...((((((...((........((((((((....((((..((......(((((...))))).....{((({..,,..((((..(((({...,,.......))))).))))..,,}}}},.}}..))))..)))))))).....(((((((({...}))))))))})...)))))}.........((((((.....{{{.....,}}..)))))).............,.))))))))))))..)))))).......((((.(((..((((..((({,{.....,}).)))).)))}...))).)))).)))))))))).)))...{(((.(((((.((((..(((..((((((,..(((..{{((((((..,,....,,|,...{{{{....{{|....))),,,)}}}..((...},,,,{{(((((,....,}})),.,,}}})))})})).)))))))))..))).))))))))).)))},.))))))))))).)}.{((({{...((((((................))))))...})))).........)))))((((..(((..((((....(((.(((((............(((((((((((((.((((......)))).)))...,})}})))....)))}.((((((((((.((((........)))).((((....(((((.(((((((..((.(((((((.((...(((.....)))....))..)))).))).)).,..)))))))))))).....))))........{((.,({(((((.(((.........))).))))))).,)))))))))))){(((....((((((........)))))).)))},{((((({.,((((((((....((((,{{{...(((((..(((...}))..))))).||||....,))),..))))...))))))))))))))).....)))))...)))))))...))).)))).(((.(((((.((...(((((((...))))))).(((....))}(((.{(((((((.((((((..(...((((.,....(((((.(((((((((((((.{({.({(.((((...))))...)})...})).)).,....}},))))))))))).)))))....,))))...}..,})))))))))))))))){{.....,,..,{((..{((...))})))|(((((........)))))}......))))))).))).))).))))))..((((....))))))))))).}}},..{(((..(((((((((((...,.(((.........)))..,,.))).)))))))).))))))))))}.,))))...{{{.(((.......}))..}}},))))))))....,||,.{{{{.....)))}..,,.}}}...((((((((((...))))))))))....................))))..)))}

Transcripts

ID Sequence Length GC content
AGCAGCCCCCCUUUGGGUCCCUUCCCUUUGUAUGGGAGCUGUUUUCAUG… 2794 nt 0.4807
CUUUCACUUAGGCAUCGAUAGCACCCAUCAGAUGGCCAAAUCAUUAUUU… 3045 nt 0.4673
Summary

Many different human endogenous retrovirus (HERV) families are expressed in normal placental tissue at high levels, suggesting that HERVs are functionally important in reproduction. This gene is part of an HERV provirus on chromosome 7 that has inactivating mutations in the gag and pol genes. This gene is the envelope glycoprotein gene which appears to have been selectively preserved. The gene's protein product is expressed in the placental syncytiotrophoblast and is involved in fusion of the cytotrophoblast cells to form the syncytial layer of the placenta. The protein has the characteristics of a typical retroviral envelope protein, including a furin cleavage site that separates the surface (SU) and transmembrane (TM) proteins which form a heterodimer. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Mar 2010]

Forensic Context

A scoping review of human twin studies found that the ERVW-1 exhibited increased mRNA and protein levels alongside decreased promoter DNA methylation in the smaller twins of birth weight discordant pairs (≥20%) [Dany Laure Wadji et al. DOI:10.1371/journal.pone.0315549].