| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUCAGAACCAAAUUGCUGAGCCAGUCACCUGUGUUCCAGGAGCCGAAUC… | 2096 nt | 0.4198 |
The protein encoded by this gene belongs to the aldehyde dehydrogenase family. Aldehyde dehydrogenase is the next enzyme after alcohol dehydrogenase in the major pathway of alcohol metabolism. There are two major aldehyde dehydrogenase isozymes in the liver, cytosolic and mitochondrial, which are encoded by distinct genes, and can be distinguished by their electrophoretic mobility, kinetic properties, and subcellular localization. This gene encodes the cytosolic isozyme. Studies in mice show that through its role in retinol metabolism, this gene may also be involved in the regulation of the metabolic responses to high-fat diet. [provided by RefSeq, Mar 2011]
A study in rat primary hepatocytes demonstrated that lead exposure significantly upregulated the ALDH1A1, which was identified as a key molecular hub functionally coalescing in critical pathways including chemical carcinogenesis and cytochrome P450-mediated xenobiotic metabolism [Li et al. DOI:10.1007/S12011-025-04902-9].