| ID | Sequence | Length | GC content |
|---|---|---|---|
| AACUUCAAAGCAAAAUGAAGUUCUUUCUGUUGCUUUUCACCAUUGGGUU… | 1584 nt | 0.4104 |
This gene encodes a member of the alpha-amylase family of proteins. Amylases are secreted proteins that hydrolyze 1,4-alpha-glucoside bonds in oligosaccharides and polysaccharides, catalyzing the first step in digestion of dietary starch and glycogen. This gene and several family members are present in a gene cluster on chromosome 1. This gene encodes an amylase isoenzyme produced by the pancreas. [provided by RefSeq, Jan 2015]
A study in human postmortem tissues from a cancer research autopsy program demonstrated that the AMY2A transcript is overrepresented in normal pancreatic tissues and can be used to discriminate gene expression signatures between normal and cancer samples via RNA sequencing, even in samples with low RNA integrity [Fan et al. DOI:10.18632/oncotarget.11836]. Furthermore, a multi-omics review of human biological age estimation identified the AMY2A protein as having higher abundance in the age-dependent urine proteome of healthy men [Solovev et al. DOI:10.1016/j.mad.2019.111192].