| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCUGGAGGGGCAGGGACGGCGGCGGCGCAGCUCGGAACCCGCCAGGGUC… | 3662 nt | 0.5841 | |
| GCUGGAGGGGCAGGGACGGCGGCGGCGCAGCUCGGAACCCGCCAGGGUC… | 3665 nt | 0.5842 | |
| CUCUGCCUGGCCUGAGGCUCCCUGAGCCGCCUCCCCACCAUCACCAUGG… | 3403 nt | 0.5760 |
Aminopeptidase N is located in the small-intestinal and renal microvillar membrane, and also in other plasma membranes. In the small intestine aminopeptidase N plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases. Its function in proximal tubular epithelial cells and other cell types is less clear. The large extracellular carboxyterminal domain contains a pentapeptide consensus sequence characteristic of members of the zinc-binding metalloproteinase superfamily. Sequence comparisons with known enzymes of this class showed that CD13 and aminopeptidase N are identical. The latter enzyme was thought to be involved in the metabolism of regulatory peptides by diverse cell types, including small intestinal and renal tubular epithelial cells, macrophages, granulocytes, and synaptic membranes from the CNS. This membrane-bound zinc metalloprotease is known to serve as a receptor for the HCoV-229E alphacoronavirus as well as other non-human coronaviruses. This gene has also been shown to promote angiogenesis, tumor growth, and metastasis and defects in this gene are associated with various types of leukemia and lymphoma. [provided by RefSeq, Apr 2020]
A study in humans demonstrated that the ANPEP is downregulated in peripheral blood mononuclear cells from patients with sacubitril/valsartan resistance compared to non-resistant individuals after acute myocardial infarction, as validated by qRT-PCR [Su et al. DOI:10.1016/j.ejphar.2023.175547]. A separate review of human multi-omics studies identified the ANPEP as a proteomic aging biomarker with higher abundance in the age-dependent urine proteome of healthy men [Solovev et al. DOI:10.1016/j.mad.2019.111192]. A study in human skin wounds demonstrated that aminopeptidase activity changes approximately 4 hours after injury [Cecchi DOI:10.1007/S00414-010-0505-X][Ros et al. DOI:10.3389/fmed.2021.786798].