Basic Information

Symbol
ANXA1
RNA class
mRNA
Alias
Annexin A1 ANX1 LPC1 Phospholipase A2 Inhibitory Protein Chromobindin-9 Calpactin II Calpactin-2 Annexin-1 Epididymis Secretory Sperm Binding Protein Annexin I (Lipocortin I) Lipocortin I Annexin I P35
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Other applications

MANE select

Transcript ID
NM_000700.3
Sequence length
1401.0 nt
GC content
0.4083

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-345.60 kcal/mol
Thermodynamic ensemble
Free energy: -377.54 kcal/mol
Frequency: 0.0000
Diversity: 422.33
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((.((((((...((((((((.......))))))))....))))))((..(((.(((((((((((((....((((((.((...(((..(((((((((..((((((.((((((...))))))(((((......)))))......(((((........(((.(((((((......))).)).))))).......)))))...((((....))))((((((((((....))))).....((((((..(((((.(((((........))))).))))).)))))))))))....((((...(((((....)))....)).)))).((((((((.....((....)))))))).)).......(((......))).))))))..))))))))).)))(((((((...)))))))..((((((((..(((.(((((((((((((((.((((((((((.((((((((((...((((((((((.(((.....))))))))..))))).................((((....((..(((..(((......)))..)))..))....))))(((((((......(((((((...............((((.((.(((.((........)).))).))..))))))))))).))))))).(((((..((......)).)))))....)))))))))).))))..)))((((((((..(...(((..((((.....((.((((((....(((.(((((.....(((((..((..(......)..))..))))).....(((.....)))..))))).)))...))))))..))))))..)))..(((((..(((...((((....)))))))..))))).........(((.......)))...)..)))))))))))..)))).)))))).)).))).))).))))))))....(((....))).....(((((((...((....))))))))).............(((((((..((((.((......)))))).)))))))..)).))))))(((((((..((((........................)))).))))))).(((((((.((.....(((((((.....(((((.((.....((((((..(((((.(((((...((((((((((((((((........))))))..((.((((....))))..)).((((((....))))))..)).))))))))....)))))...)))))..)))))).((((((...))))))...)).))))).......)))))))...))...)))))))...........((((((.....))))))...)))))))).))))).)))..))...............)))))......
Thermodynamic Ensemble Prediction
..(((((..((,,,{(((((....}))))|{{{{{{((((((......))))))|{{.(((((((((((((....((((((.((...{{{,.(((((((((..((((((.{(({{,...,}}}}}(((((......)))))...,.{((...{{{{{{{.,(({,,(((,({{{..,,||.},.}}}}}.,,},,,},},.,,,|.(({,.{||||({((((({((,...,}}||.....{(((((..(((((.(((((........))))).))))).)))))},||},....{|||...||{{{....}}},...))})))),||||{|||,....||}..})),,))))}))..}}}.,{{{......}}}.))))))..))))))))}.},|(((((((...))))))),,((((((((..(((.(((((((((({{(((.((((..((((.((((((((((...(((((,{(({.(((.....)))}}}))..))))).,......,,,{{...{(({{..,.,...{{({{(((.{{{{..||..|||,.{|,{,.||||{,,,,||,.....|{||||,....}))},,},,,,{{((.((.(({,((..,,,,,,}}.,}},))..)),,))))}}},)))))||,{{{{{.|,,......}}.})))).,,.)))))))))).}))).))))}))}.{((((......(((((.{{,....},}}))).....,.)))}|.,.....({{(,..,,....,||||||.|}{{||||}.,,},|||.,,,.||.,,|,,}|,,}}...}},,},..}))))).,)})}}{((((..((({,.{(((....}}}))))..))))).,,|||,,}|{|......,}}.....|||||{{{|..,,)}))))}))))))},)},)).))).))))))))....(((....))).....(((((({.,,((...,),)))))))...,......,,,(((((((..((({{((......}))))).)))))))..)).))))))((((({(,.((((....,{{.{,....}}.}}.....)))).))))))).{{((({({(((({{{.,,{{{,...,,{((((,{|...,.,{{|||,,(((({.,{,,,...{|,,|||||.((((((........)))))).}}}}|||}}.,})))}...{,((((((....)))))},|}),,,,,}}})}...,}|||.,.|||||,.}||||,.((((((...)))))).,.}}.}}|||.....,,))))}}},.......,,}}},,...........((((((.....))))))...)))))))).))))).}}}.,))},.........}}..))))}......

Transcripts

ID Sequence Length GC content
AGUGUGAAAUCUUCAGAGAAGAAUUUCUCUUUAGUUCUUUGCAAGAAGG… 1401 nt 0.4083
Summary

This gene encodes a membrane-localized protein that binds phospholipids. This protein inhibits phospholipase A2 and has anti-inflammatory activity. Loss of function or expression of this gene has been detected in multiple tumors. [provided by RefSeq, Dec 2014]

Forensic Context

A study in mice demonstrated that the ANXA1 is elevated during both lethal and non-lethal Escherichia coli-induced sepsis, and validation using human patient data confirmed its diagnostic potential for distinguishing septic patients from healthy individuals [Zhang et al. DOI:10.1093/jimmun/vkaf140]. A study in mice demonstrated that the ANXA1 is a promising marker for age estimation of venous thrombi, as its expression in thrombosed inferior vena cava tissue is time-dependently up-regulated after deep vein thrombosis induction, with protein levels peaking at 14 days and mRNA levels peaking at 10 days post-ligation [Huang et al. DOI:10.007/s12024-024-00818-3].