| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUGUGAAAUCUUCAGAGAAGAAUUUCUCUUUAGUUCUUUGCAAGAAGG… | 1401 nt | 0.4083 |
This gene encodes a membrane-localized protein that binds phospholipids. This protein inhibits phospholipase A2 and has anti-inflammatory activity. Loss of function or expression of this gene has been detected in multiple tumors. [provided by RefSeq, Dec 2014]
A study in mice demonstrated that the ANXA1 is elevated during both lethal and non-lethal Escherichia coli-induced sepsis, and validation using human patient data confirmed its diagnostic potential for distinguishing septic patients from healthy individuals [Zhang et al. DOI:10.1093/jimmun/vkaf140]. A study in mice demonstrated that the ANXA1 is a promising marker for age estimation of venous thrombi, as its expression in thrombosed inferior vena cava tissue is time-dependently up-regulated after deep vein thrombosis induction, with protein levels peaking at 14 days and mRNA levels peaking at 10 days post-ligation [Huang et al. DOI:10.007/s12024-024-00818-3].