| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAGACAGGCAUCUCAAAUCGGCUGAUUCUGCAUCUGGAAACUGCCUUCA… | 862 nt | 0.4872 |
This gene encodes a component of high density lipoprotein that has no marked similarity to other apolipoprotein sequences. It has a high degree of homology to plasma retinol-binding protein and other members of the alpha 2 microglobulin protein superfamily of carrier proteins, also known as lipocalins. This glycoprotein is closely associated with the enzyme lecithin:cholesterol acyltransferase - an enzyme involved in lipoprotein metabolism. [provided by RefSeq, Aug 2008]
A study in human skin wound healing identified the APOD as a marker for an APOD+ pro-inflammatory fibroblast subcluster (FB-II) [Liu et al. DOI:10.1016/j.stem.2024.11.013].