| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUCCCCUCAGGUGUCCUGCAGGCACAGCAUCUCGGGGGGCCCAGGCCGA… | 1099 nt | 0.6588 |
Predicted to enable channel activity. Predicted to be involved in transmembrane transport and water transport. Predicted to be located in membrane. Predicted to be active in cytoplasm. [provided by Alliance of Genome Resources, Jul 2025]
A study in Wistar rats demonstrated that severe scald injury induced synchronized increases in myocardial water content and the expression of the AQP12B, with mRNA levels peaking at 12 hours post-injury and showing significant upregulation in a delayed fluid resuscitation group compared to an immediate resuscitation group as detected by gene microarray [Li et al. DOI:10.3906/sag-1401-149].