| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGCCGCCAGCCUCGGAGUGGGCGCGGGACAGUGCGCGGCGCCCCGCAG… | 1449 nt | 0.6384 |
Aquaporin 5 (AQP5) is a water channel protein. Aquaporins are a family of small integral membrane proteins related to the major intrinsic protein (MIP or AQP0). Aquaporin 5 plays a role in the generation of saliva, tears and pulmonary secretions. AQP0, AQP2, AQP5, and AQP6 are closely related and all map to 12q13. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that intrapulmonary expression of the AQP5 was significantly suppressed at both gene and protein levels specifically in freshwater drowning (FWD) compared to saltwater drowning (SWD), postmortem immersion, and control groups [Hayashi et al. DOI:10.1007/S00414-008-0235-5]. A study in human lung tissue from forensic autopsy cases demonstrated that the AQP5 mRNA expression was significantly lower in smothering and choking groups compared to strangulation, sudden cardiac death, and acute brain injury groups [Wang et al. DOI:10.1016/J.Forsciint.2012.02.013].