Basic Information

Symbol
AREG
RNA class
mRNA
Alias
Amphiregulin CRDGF AR Colorectum Cell-Derived Growth Factor AREGB SDGF Schwannoma-Derived Growth Factor Amphiregulin B
Location (GRCh38)
4:74444999-74455005
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Cause of death analysis Other applications
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_001657.4
Sequence length
1234.0 nt
GC content
0.4530

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-352.20 kcal/mol
Thermodynamic ensemble
Free energy: -374.19 kcal/mol
Frequency: 0.0000
Diversity: 293.83
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((((((..(((((.((....)))))))..))...(.(((((((((.(((((((((...((.((...(.(((((.....((((((..(((((((.....((.(((((((.....((.............))......(((.(((((((((.(((.....)))))))))))))))))))))).))...))))))).))))))......).)))).).)).))...)).)))))))..))).)))))).)((((((.....(.((((((((((((.((.((((...(((.((((((((.(((((.((...)).)).)))...)))....))))).))))))))))))))).)))))).)....)))))).)))).))))))...((.(((((...((((..(((((.....(((((((((((((((....(((..((((...))))..))))))))).))))).))))..((((..(((......((((((((..(((......)))..)))))).))......))).)))).((((((((..........)).(((((....))))).........................))).)))......................................(((.((.(((((((((.........))))))))))).)))...(((...........)))((((....((((...((((...(((.((((.(.(((((((.((....(.((((((................)))))).).((((.(((....))).))))....((((....))))((.(((((.((((((((((((.((((.((.((..(((((..(((((....))))).)))))..)).))...)))).)))...)))))))))...))))).))..((((......))))........)).))))))).).))))))))))).))))............))))...)))))..))))))))).))((((...((((((..((((((((..((((((((((((...)))....))))....)))))...)))))))).))))))....))))....((((((((((((((((.......))))).))))))).)))).((((((((((.........(((((((((.(((.(((((............))))).)))...)))))))))......)))))))..)))...
Thermodynamic Ensemble Prediction
..{(.((((..(((((((({(,...}))))}.(((((((.(.(((((((((.((((((({(...((.((...(.((((,,...,((((((..(((((((,....((.(((((((.....{,.......,.....,,..}}..(((.(((((((((.(((.....)))))))))))))))))))))).)).,.))))))).)))))).,....}.)))).,.)).))...})}}))))))..))).)))))).),,..,....{{(((...{|{.....,}|}}}})}...))))))).,{{...(({,...}))}.,,})),..((((((((({{,..|,.,..((((((((.{,{(((({...})))},{{{{,,,,....)))).(((((......)))))((((((((...(((((((((((((((....(((..((((...))))..))))))))).))))).))))..,,{{..{((,,....((((((((..(((,....,}}}..}))))).)),...,,})).}}}}.((({(((,..........||.,,,(({,...,,))),.......,,..............))).)))....,{,,,.............................|||,|(.(((((((((.........)))))))))}).}}}...,,{...........}||||||...{||,...,.|||..,,||,.}|,.,....}))}}}))..},,}||||({,....))).,....))))))))..((((.(((....))).))))....,}.)))))))).((.(((((.((((((((({({{((((.{{.{(..(((((..(((((....))))).)))))..)}.)),..}}}).)))...}))))))))...))))).))..((((......)))).,.)))))))))..(((((((.(..(((((((((..{,,({{{,.....{{((({.((,,..|||,}}}.}}}..{(((.,.{(((({..{((({(({..(((((,,{|{{|.||)}}.,,,,,)}.,..)))))...}))))))).))))))....)))}....)))))..,,.)))))))))..))))))))..)))))..)))),||(((((((..,,.....((((((((({((,.(((({..,,,...,},.)))}).}.)})})))))))))....)})))))))...,,...

Transcripts

ID Sequence Length GC content
NM_001657.4 NCBI
AGACGUUCGCACACCUGGGUGCCAGCGCCCCAGAGGUCCCGGGACAGCC… 1234 nt 0.4530
Summary

The protein encoded by this gene is a member of the epidermal growth factor family. It is an autocrine growth factor as well as a mitogen for astrocytes, Schwann cells and fibroblasts. It is related to epidermal growth factor (EGF) and transforming growth factor alpha (TGF-alpha). The protein interacts with the EGF/TGF-alpha receptor to promote the growth of normal epithelial cells, and it inhibits the growth of certain aggressive carcinoma cell lines. It also functions in mammary gland, oocyte and bone tissue development. This gene is associated with a psoriasis-like skin phenotype, and is also associated with other pathological disorders, including various types of cancers and inflammatory conditions. [provided by RefSeq, Apr 2014] CIViC Summary for AREG Gene

Forensic Context

A study in porcine skin demonstrated that the AREG was significantly increased in response to both sulfur mustard and thermal burn injury at 7 days postexposure, identifying it as a potential therapeutic target for wound healing [Price et al. DOI:10.080/15569520903097754]. In human skin wound healing, single-cell analysis identified the AREG as an EGF family ligand that is rapidly upregulated in migrating keratinocytes, serving as an autocrine pro-migratory signal [Liu et al. DOI:10.1016/j.stem.2024.11.013]. A study in humans using post-mortem tissue RNA sequencing demonstrated that septic shock induces a highly heterogeneous transcriptomic response across six organs, with the lungs and colon being most affected, showing both gene activation and strong inhibitory signals [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938]. The investigation identified numerous differentially expressed genes involved in immune, metabolic, and senescence pathways, providing evidence of tissue-specific alterations and accelerated ageing in sepsis; however, the AREG was only mentioned in the introduction and discussion as an EGFR ligand implicated in shedding by ADAM proteases and was not experimentally studied in this paper.