Basic Information

Symbol
ASCL1
RNA class
mRNA
Alias
Achaete-Scute Family BHLH Transcription Factor 1 HASH1 BHLHa46 ASH1 Class A Basic Helix-Loop-Helix Protein 46 Achaete-Scute Homolog 1 ASH-1 Achaete-Scute Complex (Drosophila) Homolog-Like 1 Achaete-Scute Complex Homolog 1 (Drosophila) Achaete-Scute Complex-Like 1 (Drosophila) Achaete-Scute Complex Homolog 1 Achaete-Scute Complex-Like 1 Achaete Scute Protein BHLHA46 MASH1
Location (GRCh38)
Forensic tag(s)
Sudden unexpected death diagnosis

MANE select

Transcript ID
NM_004316.4
Sequence length
2481.0 nt
GC content
0.5204

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-874.00 kcal/mol
Thermodynamic ensemble
Free energy: -910.81 kcal/mol
Frequency: 0.0000
Diversity: 773.36
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((.(((..((((((((.(((..(.((...((....))..)).)..))))))))))).))).)))))((((((((((((((.((((((.((((((.......(((((.....(((((........)))))(((((((.(.....((((.((((.((((((.(..((((.((((..((.(((((((..(((((((.((.......)).)))......(((((((((..(((((((((.((((...)))).)))))))))..)))))))))(((......))).(((.((((((((((((...((......))...)))))((((((((((((((((((((((.(.((.(((((.((((((((........)))))))).))))).......((((((((...))))))))..................((....)))).)))))).......)))))))))))))).))).......((((...((....))..))))...)))))))))).))))..))))))).))...)).))))))..).))).)))))))))))..((((((((.((((.(..((((.....(((.(.((.(((((...(((.....)))...))))).))))))))))..)))))))).....)))))).))))))).((((((((....((.((((((((....)))))))).)).((((((((..((((((.((.((.((.((.((....)).)).)).)).))..))).)))..(((((...(((((((...)))).)))))))).((((((.....((.((((((....((.......))....))))).).)))))))).......))))))))....(((((((...((.(.(((((...(((....))).))))).).)).))))))).))))))))(((((((.......))).))))..(((((((..(((((.......((((..(((..((....))..))).)))))))))))))))).......(((((((.((..(((((.((((..(((((((.((((((.((.(.((((.((((((...)))).)))))).).)).)))).)).)))))))(((((.......)))))...))))..))))).((((((((..((((.(((..(((..(((......((((((....))))))............(((.((.(((((.((...((((.(((.(((((((((((((....)))))))......(((....))).....)))))).)))..))))))))))).)).)))..(.(((..(((.((((((((....)))..))))).)))..))).).)))..)))..))).).)))..))))))))...((((((((.........((((.((.(((((...((((..((((.............................((((.......))))(((.(((.(((((((....((((((........))))))((((......(((((((((...............)))))))))...))))....((((((((((.(((.(.((......(((((((((((....((..((((((((((.......)))))).((....))((((...))))..))))...))....)))))).)))))...)).))))))))))))))..((((..((((...(((((...((.((........)).))..)))))))))..))))....)).))))))))))).............(((((((((....)))))))))........(((......))).))))....)))).))))).))((((((..............))).)))))))..........)))))))))))))))))))))).....))))))..)))))).)))...((((((((((((((((((...(((((((..((..........)))))))))...)))).)))))))).))))))(((((((((((((........((((((((((((((((.((........)).)))))((((((((((.((((((.......((((.....(((((((((...))))))))).......((((((((.............((((((((.....((.(((.(((...))).))).))..)))))))))))))))).....((((....))))........))))......)))))).))))))).)))............(((((.....))))).(((((..((((...))))..)))))(((((.(((((((.(((......))).)))))))))))))))))))))))......)))))))))))))...(((((((((((((((..........(((((((.......)))))))....))))).))))))))))..)))))))))))...........
Thermodynamic Ensemble Prediction
..(((((.(((.{{(((((((.(((..(.((...((....))..)).)..))))))))))).))).)))))((((((((((((((.((((((.((((((........,,,,.....(((((........))))){{({({(,(.,...|||{(({{({(((({{.,,,,.,(((((({,{{...((..((((((......))))))..)).{{{.{{.{{(((((((((.((((({{{{{.(((({{.}}}}.}))))}((({,{(((({,({(....,{((({(,(({.((((((((((((...((......))...))))}((((((((((((((((((((((.(.((.(((((.((((((((........)))))))).)))))....,..((((((((...))))))))..,...............((....)))).)))))),,....,)))))))))))))),)}}.......{(((...((....,,.,)))}...)))))))))}..,}}..}))))||,.,((((({{...},..,,)})),}}}..))}.||}||||}||..(({{,({,(({(.....{||,|,|(.(((((...(((.....)))...))))).))}}}}}}}}..,}}})|{{{{{..((.{{{|{{..,..,||,.,|||.||.{,.((((((((....)))))))).)))))|((((...||))||,||,|{,||,||}||}}.,)),)},||.||.||..}}}},}}.}}|((({(((((((((,..((((,(((((...}))))||,,.,,{({(,(({{....||..{,{..|||||.{||||{|,,}}|||.||...||.,|||||||....(((((((...((.,.(((((...(((....))).))))).).}).))))))).|||)))))||||||,..,}.},))),))))..(((((((..(((((,,.....((((..(((..((....)),.))).))))))))}})))}))....{..{..,.,(((({.((,({{{{,,,,{{||||{.((({{(.{{.{.{||||||{{{{,.,}})),))}))),,,)).)))),)),)}})))),((({...)))).((((......)))).....}}}}},}}...}}}}|,,.,||))))....}}.}))})))).)))))))))).}}},,}|{{(((.((.(((((.((...((((.(((.(((((((((((((....))))))),.,,,.(((....)))...},)))))).)))..))))))))))).)).))}.}},{{{..(((.((((({((....}})..))))).)))..}))))))))))))},|||},},||||,||||||||{..||{.,.,..........,..,.,,..,.,,....((({.{,{{,......,,,.....,,,........{{.((((.......))))||{,{{.{({{{{|.|,,,((((((.,......))))))((((......(((((((((...............))))))))),..))))....((((((((((.(((.(.{{......(((((((((((....,{..((({((((((.......)))))).{|,,..}}((({...}}}}..,,,,...,,.,..)})))),)))))...)).})))))))))))))..{{{{..{{{(...(((({.,.|{.((........)).}}..)))))))))..)))),}}}}},))))||||||..............(((((((((....)))))))))........)))})},|||,,.,,,}},...})).,))))))))}.{{{,......}}}...,,,..,})}}})})},...,,}))))))},...,||||.,,,,,,}},,))))))..)))))).)))..,((((((((((((((((((...(((((({..((..........)))))))))...)))).)))))))).))))))|((((((((((((........(((((((((((,,,,,..,.{({{{{{{{(((((,,,,,((((((.{{{,,,.,|||.,.}}))}...,|||||||}}}}))),|((((({........|}))))}..{{{{{{{{{(,(({{{{,,...||}|,,.||.}}}))).)))}}|{{|||||,|||}||||}}...,|{{({,,,{||}|{{........)),,||||||||||.|||})))|))}}}}.,|||||..(((((.....))))).,||||..(({(,,,||}}..}}}},{{{||}|||{||{.|||}},...))}.))),)))))))))))))))))))......)))))))))))))...(((((((((((((((..........(((((((.......)))))))....))))).))))))))))..)))))))))))...........

Transcripts

ID Sequence Length GC content
AGCACUCUCUCACUUCUGGCCAGGGAACGUGGAAGGCGCACCGACAGGG… 2481 nt 0.5204
Summary

This gene encodes a member of the basic helix-loop-helix (BHLH) family of transcription factors. The protein activates transcription by binding to the E box (5'-CANNTG-3'). Dimerization with other BHLH proteins is required for efficient DNA binding. This protein plays a role in the neuronal commitment and differentiation and in the generation of olfactory and autonomic neurons. Mutations in this gene may contribute to the congenital central hypoventilation syndrome (CCHS) phenotype in rare cases. [provided by RefSeq, Jul 2008] CIViC Summary for ASCL1 Gene

Forensic Context

Postmortem studies in humans indicate that the ASCL1 protein, a marker for oligodendrocyte precursors, shows increased staining in the ventromedial prefrontal cortex of individuals who died by suicide compared to controls [Yamamoto et al. DOI:10.3390/Ijms25115750].