| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUACUAACAUGGACUAAUCUGUGGGAGCAGUUUAUUCCAGUAUCACCC… | 2234 nt | 0.3433 | |
| AGUACUAACAUGGACUAAUCUGUGGGAGCAGUUUAUUCCAGUAUCACCC… | 2467 nt | 0.3445 |
This gene encodes a cartilage extracellular protein that is member of the small leucine-rich proteoglycan family. The encoded protein may regulate chondrogenesis by inhibiting transforming growth factor-beta 1-induced gene expression in cartilage. This protein also binds collagen and calcium and may induce collagen mineralization. Polymorphisms in the aspartic acid repeat region of this gene are associated with a susceptibility to osteoarthritis, and also with intervertebral disc disease. Alternative splicing of this gene results in multiple transcript variants.[provided by RefSeq, Jul 2014]
A study in mice demonstrated that the ASPN exhibited high expression in an "apoptotic fibroblast" cluster within radiation-induced skin injury, as identified via single-cell RNA sequencing [Yu et al. DOI:10.1186/s40164-025-00596-w]. In human heart tissue, a meta-analysis of microarray datasets found the ASPN was significantly up-regulated across multiple structural heart diseases, with a mean fold change of 3.1542, and was part of a 62-gene signature achieving approximately 95% classification accuracy for distinguishing diseased from control samples [Fajarda et al. DOI:10.1186/s13040-020-00217-8].