| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCCAUUUCUACUUUGCCCGCCCACAGAUGUAGUUUUCUCUGCGCGUGU… | 2041 nt | 0.5625 | |
| CAUUUCUACUUUGCCCGCCCACAGAUGUAGUUUUCUCUGCGCGUGUGCG… | 1419 nt | 0.5321 |
This gene encodes a transcription factor that was originally identified as a widely expressed mammalian DNA binding protein that could bind a tax-responsive enhancer element in the LTR of HTLV-1. The encoded protein was also isolated and characterized as the cAMP-response element binding protein 2 (CREB-2). The protein encoded by this gene belongs to a family of DNA-binding proteins that includes the AP-1 family of transcription factors, cAMP-response element binding proteins (CREBs) and CREB-like proteins. These transcription factors share a leucine zipper region that is involved in protein-protein interactions, located C-terminal to a stretch of basic amino acids that functions as a DNA binding domain. Two alternative transcripts encoding the same protein have been described. Two pseudogenes are located on the X chromosome at q28 in a region containing a large inverted duplication. [provided by RefSeq, Sep 2011]
A study in rats and pigs demonstrated that the ATF4 exhibits analogous time-dependent expression patterns in skeletal muscle following contusion injury and is part of a molecular framework enabling cross-species injury time inference [Wang et al. DOI:10.1007/s00414-026-03727-y].