| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAGCAGACACAAUGGUAAGAAUGGUGCCUGUCCUGCUGUCUCUGCUGCU… | 1181 nt | 0.5385 |
Predicted to enable RNA nuclease activity and protein transmembrane transporter activity. Involved in cell adhesion and detection of chemical stimulus involved in sensory perception of bitter taste. Located in extracellular space. Implicated in prostate carcinoma. Biomarker of several diseases, including gastrointestinal system cancer (multiple); kidney failure (multiple); liver cirrhosis; lung adenocarcinoma; and obesity. [provided by Alliance of Genome Resources, Jul 2025]
A study in humans demonstrated that the AZGP1 is downregulated in cardiomyocytes from the non-infarct left ventricle of patients with ischemic cardiomyopathy [Simonson et al. DOI:10.1016/j.celrep.2023.112086]. A separate human study in BMI-discordant monozygotic twins found the AZGP1 was downregulated in the subcutaneous adipose tissue of heavier co-twins, where it is involved in processes including antigen presentation and negative regulation of cell proliferation [Muniandy et al. DOI:10.1038/ijo.2017.95]. A study in humans identified zinc-alpha-2-glycoprotein (ZAG) as a protein that non-specifically interacts with an anti-EPO antibody (clone AE7A5) during doping control analyses [Reichel DOI:10.1016/J.Forsciint.2011.07.031].