Basic Information

Symbol
AZGP1
RNA class
mRNA
Alias
Alpha-2-Glycoprotein 1, Zinc-Binding ZAG ZA2G Zinc-Alpha-2-Glycoprotein Zn-Alpha-2-Glycoprotein Zn-Alpha-2-GP Testicular Tissue Protein Li 227 Alpha-2-Glycoprotein 1, Zinc Alpha-2-Glycoprotein, Zinc Zn-Alpha2-Glycoprotein ZNGP1
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Individual identification Other applications

MANE select

Transcript ID
NM_001185.4
Sequence length
1181.0 nt
GC content
0.5385

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-402.80 kcal/mol
Thermodynamic ensemble
Free energy: -420.62 kcal/mol
Frequency: 0.0000
Diversity: 251.99
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((.(((((((.......((((....(((((((((((((.((((((((((((((((((.(((.....))).)).((((...)))).....(((((((.(((...(((......((((((((..((....(((.(((((....))))))))((((...))))...(((((..((((((.((((((...(((....))).........(((((((.....)))))))(((....)))...)))))).)))))))))))..)).))))))))......)))))).)))))))((..(((((..((....))..)))))..))(((((...((((.......))))(((.((((((((...(((((((.(((((((.(.(((((((........(((((((......)).)))))........................((((((((..((((((.......(((.((((((((((......)))))))...((((................)))).(((....((((.(((((.(..((((((((.((((...(((((((((.(...(((((.(((((...((.....((((.................(((.(.(((((..((((((((((..((((.((((...((...(((((((.(((..............)))..).)))))).))..)))).))))..)))))...............))).))..)))))).)))..))))..)).))))).)))))...).)))))).....(((..(((......))).))).((((((.((.(((.(((((......)).))).)))))))))))((((.....))))..))).)))))))))).))..).)))))....))))...))).))).))).......))))))..))))))))))))))).).)))).....))).)))))))...)))))))).)))..(((..((........))..))).)))))..))))).)))))))))).).)))))))).)))))(((((.(((((...)))))...((((...((.((((.....))))..)).)))).........((((...)))).)))))..)))))))))))....)))))....((((.......................)))).
Thermodynamic Ensemble Prediction
..(((((.(((((((.......((((....(((((((((((((.({((((((((({((,(((,,((((...{{{(.,..(((,{{||||,,{,.(((((((.(((...(((......((((((((..((....(({((((((....))))))))((((...)))}...{((((..((((((.((((((...{{(....{{.....{{{..(((((((.....)))))))|||...,),,}}}}))))).)))))))))))..)).))))))))......)))))).))))))))))}||||{.}||....))}},,,))}},}((({{....,,{..,,,..)),.(((.((((((((...(((((((.(((((((.(.(((((((........(((((((......)).)))))......,,.,,.....,.......((((((((..((((((.......(((.((({((((((......))))))|{..(((({....,...{{{{.,{||||.(((....{{,{,{{{{(,{..(({((({.,{{||..}||||{((((((.(((((((({....}))))......{{{.....|||..........,,}....))))...)))))),||{{(((.((.({{..((((((({{{{,{(((.....{{......}},..,,,}}}}}||}...,.,.((((((((({.....{{,.((((.(((((((((((((.((,...,))..).))))))))).)))(((({...)))))...........,))))}},.,,,)))))))))),)))))).)))}),))))))}.....}}}.}}}}}).))})...,,||,,,.},},}}}}}|||}}.))..}.}}))),,,,)))))..)),.))).))).......))))))..))))))))))))))).).)))).....))).)))))))...)))))))).)))..(((..((........))..))).)}}}).}))))).)))))))))}.).)))))))).)))))(((((.(((((,{,|}||,...((((.,.({.((((.....))))..)),))))........,|||,...}))}.)))))..)))))))))))....)))))....((((...................,...)))).

Transcripts

ID Sequence Length GC content
AAGCAGACACAAUGGUAAGAAUGGUGCCUGUCCUGCUGUCUCUGCUGCU… 1181 nt 0.5385
Summary

Predicted to enable RNA nuclease activity and protein transmembrane transporter activity. Involved in cell adhesion and detection of chemical stimulus involved in sensory perception of bitter taste. Located in extracellular space. Implicated in prostate carcinoma. Biomarker of several diseases, including gastrointestinal system cancer (multiple); kidney failure (multiple); liver cirrhosis; lung adenocarcinoma; and obesity. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in humans demonstrated that the AZGP1 is downregulated in cardiomyocytes from the non-infarct left ventricle of patients with ischemic cardiomyopathy [Simonson et al. DOI:10.1016/j.celrep.2023.112086]. A separate human study in BMI-discordant monozygotic twins found the AZGP1 was downregulated in the subcutaneous adipose tissue of heavier co-twins, where it is involved in processes including antigen presentation and negative regulation of cell proliferation [Muniandy et al. DOI:10.1038/ijo.2017.95]. A study in humans identified zinc-alpha-2-glycoprotein (ZAG) as a protein that non-specifically interacts with an anti-EPO antibody (clone AE7A5) during doping control analyses [Reichel DOI:10.1016/J.Forsciint.2011.07.031].