Basic Information

Symbol
AZU1
RNA class
mRNA
Alias
Azurocidin 1 HBP Heparin-Binding Protein HUMAZUR CAP37 AZAMP NAZC AZU Cationic Antimicrobial Protein CAP37 Cationic Antimicrobial Protein 37 Neutrophil Azurocidin Azurocidin HHBP
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_001700.5
Sequence length
907.0 nt
GC content
0.6748

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-403.60 kcal/mol
Thermodynamic ensemble
Free energy: -417.72 kcal/mol
Frequency: 0.0000
Diversity: 233.51
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......((((((((.((((((((((((...((((.((((..((((.((((((((((((..(((((..(((....))))))))..))))...))))))))))))..)))).))))..(((((.........)))))......((((..((....((((...((((((((((((......(((((.((((((...(((.(((((.(((....((((((...))).)))....))).))))).))).)))).)))))))((((........))))(((((((.......)))))))((.(((((((..(((......)))..))))))).))...)))))).))))))))))...)).)))).))))..))))))))...((((((....))))))..((((.((....)).))))..((((....))))..((((((((((((((((((((((........))).)))))))(.(((.((((.(((.((((((((((.(.((...((((((...((((.((((...))))...))))...)))))).)).).))))))......(((.((((....)))).))))))).))).)))).))).)...(.(((((((((.....))))))))).).(((((((((((.((((...((((.((........)))))))))))))).)))))))......))))))...))))))....((((....)))))).))))))...........(((((..(((((.(((....((((((((((.((.......((((((...(((.................)))))))))........)).)).)))))).)).))).))))).))))).((((((((...(((((..........)))))....)))))))).
Thermodynamic Ensemble Prediction
.......,....,,..(((((.((((((..((((((.((((((((..,({.(((((((..(((((..(((....))))))))..))))...{,{((,(((((((((({,.((({{{|,,.{.||{|,,,||{||||.||,.,(((.,(({{((({((,,,((({{{{|||||||}...(((((.((((((...(((.(((((.(((....((((({...}))},))....))).))))).))).)))).)))))))||||.,,,.,,,)))}(((((((,,,,,,,|}}}|}}{{.(((({{(..{{(,,,,,,|}||.}}}}}}},},...}}}}}}.))))}}})}}.....}))})}})))}},|,{{{{,...((((((....))))))..|)}}}||}}}},,.}})},}|||||}},|,{((.((((((((((((((((((((((........))),})))))){,(((,((((.(((.((((((((((.(.((...((((((...((((.((({...})))...))))...)))))).)).).))))))......(((.((((....)))).))))))).))).)))).))).)...(.(((((((((.....))))))))).),((((((((({((((((...((((.((........)))))))))))))).)))))))......))))))...)))))).}},{{{|,...}))).,}..(({{{{...,,,,,}}}|||},||||||}.|}}}.(((((((,,(,(..{{{{...))}),.}}},,,,}}}}},,.....,,}))}|},}})}.,...........))|}}}))),,,)))..}),.)))))))).))))))..))))))........))))).............

Transcripts

ID Sequence Length GC content
CUGCCCCGCCAUGACCCGGCUGACAGUCCUGGCCCUGCUGGCUGGUCUG… 907 nt 0.6748
Summary

Azurophil granules, specialized lysosomes of the neutrophil, contain at least 10 proteins implicated in the killing of microorganisms. This gene encodes a preproprotein that is proteolytically processed to generate a mature azurophil granule antibiotic protein, with monocyte chemotactic and antimicrobial activity. It is also an important multifunctional inflammatory mediator. This encoded protein is a member of the serine protease gene family but it is not a serine proteinase, because the active site serine and histidine residues are replaced. The genes encoding this protein, neutrophil elastase 2, and proteinase 3 are in a cluster located at chromosome 19pter. All 3 genes are expressed coordinately and their protein products are packaged together into azurophil granules during neutrophil differentiation. [provided by RefSeq, Nov 2015]

Forensic Context

A study in humans identified the AZU1 as a key immune-related gene and potential biomarker for burn injury, showing it was significantly up-regulated in burn patients compared to controls in both external dataset validation and qRT-PCR analysis of clinical blood samples [Niu et al. DOI:10.1093/jbcr/irad050].