| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUGCCCCGCCAUGACCCGGCUGACAGUCCUGGCCCUGCUGGCUGGUCUG… | 907 nt | 0.6748 |
Azurophil granules, specialized lysosomes of the neutrophil, contain at least 10 proteins implicated in the killing of microorganisms. This gene encodes a preproprotein that is proteolytically processed to generate a mature azurophil granule antibiotic protein, with monocyte chemotactic and antimicrobial activity. It is also an important multifunctional inflammatory mediator. This encoded protein is a member of the serine protease gene family but it is not a serine proteinase, because the active site serine and histidine residues are replaced. The genes encoding this protein, neutrophil elastase 2, and proteinase 3 are in a cluster located at chromosome 19pter. All 3 genes are expressed coordinately and their protein products are packaged together into azurophil granules during neutrophil differentiation. [provided by RefSeq, Nov 2015]
A study in humans identified the AZU1 as a key immune-related gene and potential biomarker for burn injury, showing it was significantly up-regulated in burn patients compared to controls in both external dataset validation and qRT-PCR analysis of clinical blood samples [Niu et al. DOI:10.1093/jbcr/irad050].