Basic Information

Symbol
SLC2A1
RNA class
mRNA
Alias
Solute Carrier Family 2 Member 1 GLUT-1 DYT18 GLUT1 DYT9 Choreoathetosis/Spasticity, Episodic (Paroxysmal Choreoathetosis/Spasticity) Solute Carrier Family 2 (Facilitated Glucose Transporter), Member 1 Solute Carrier Family 2, Facilitated Glucose Transporter Member 1 Human T-Cell Leukemia Virus (I And II) Receptor Glucose Transporter Type 1, Erythrocyte/Brain HepG2 Glucose Transporter Dystonia Gene 18 Dystonia Gene 9 HTLVR GLUT CSE Receptor For HTLV-1 And HTLV-2 GLUT1DS SDCHCN DYT17 EIG12 PED
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_006516.4
Sequence length
3384.0 nt
GC content
0.5334

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1227.4 kcal/mol
Thermodynamic ensemble
Free energy: -1288.54 kcal/mol
Frequency: 0.0000
Diversity: 668.32
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((..(((((.((((((((((.((...)).))))).))...(((((((((((((.(.((.(..(((.(((((((...........((((((((.(((((.((((((((((((.(((((((.(((((((((((((..((((((.......))))))))..(((.(((((.....))).))..)))((((...((((((..(((((.((.((.(((((..((((..((((.....))))..)))).(((.......)))))))).))..)).))))))))))).)))).....(((((((.....(((((((...(((((((((((((((((.(((..(((.......(((((((.(((......((...((((.((......)).))))...))....))).).))))))....)))..))).)))))..))))..))))))))...))))))).....))).))))...)))).....))))))))))).))).))).((((((((((((((...((.(((((..(.(((.((.((.((((.((((((((((....)))).))))))..)))))))).))).).))))))))))))))))))))).))))))))))))))(((((((((.(((((((((..(((((((((....)))))))))(((((....)))))(((((((.(((.((....)).)))....(((...))).........))))))).((((.....)))).....))))))).)).))).)))))).....((((....))))...........))))))))...(((((((...))))))).))))))))))..).)).).)))).(((((((.((.(((((((.((.((..((((((((((..(((.((...(((((((((..((((((((((.((..(((........((((..(((((.(((.(.(.((.(((.......(((((......(((.......)))(((((......)))))))))).....))).)))).)))))))).)))))))..)))))))))))).)))))).))).(((((..((((.((((......(((...))).......)))).))))..))))).(((.....)))..)))))..))))).))))).)).)).(((((((.......)))))))......))))))).))..))))))).))).))))))))))))))....)))))((((((.(((..(((((((.......))))))).))).))))))..(.(((((((......(((((((((.((.((((.((((((((((((....))))).((((((.......((((.((((((((((((........(((((..(.((((((((...)))))))).)(((..((((((((((((...(((......))).......((((((((.(((......))).))((....)).))))))....((((((.(.(((.((..................)).))).))))))).(((...(........)...))).........(((((((((.((..((((((((....((((...))))..))))))))..))(((((((((((.((((...(((......))).....).))))))))..))))))(((((.(((((........))))))))))(((((...((...(((.((((...)))))))))...))))))))))))))...)))))))))))).)))........(((((....)))))..)))))))))).))))))))))).....)))).))))))))).)))))).)))))))))........))))))).)...((((((((.((...((((((((....(((....)))..))))))))......((((......)))).)).))))))))........(((((.((((((((..(((((...(((((((((...(((......))).....))))).))))(((((((((((((.(((.((((...............((((((.........)))))).....(((((...)))))........(((((.((.....)).)).))).....(((((((((((....))))))..)))))...((((((....((((......))))))))))(((....)))..((.((((((((.(((((((((.((((((..((((..................))))....)))))).((((....)))).))))))))).)))))))).)))))).)))....))))).))))))))......(((((((((.(((....((((((((((.(((((....(((((.((.((......((.....))......)).)).)))))))))).))((((((...((((((................(((((((((...........((((.((((.....))))...))))))).)))))))))))).))))))...))))...(((((.........)))))........((((.((....((((.(.((((((.....((..(((((...(((((((((((((.((((..((((((....(((((((.(((..((((((.....))))))((((((.(((.(((((((((.............(((((((((((......(((((......(((((......)))))((.(((.....))).)).....((((...((((.(((.(((((((((((((((((((((......))))).((((((((......)))))))).........((((.(((...))))))).))))))).....))))))))).)))))))...))))........))))).......))))).)))))))))).)))))...)))...))))))....))).))))))).....((((........)))).))))))......))))...))))))))...))))).)))))..))......)))))).)))))....)).))))..((((((((((((((......((((.((........(((...(((......))))))..)).))))....))))..........))))))))))...............(((......))).(((((((.((......((((..((.(((.(((....)))..))).)).))))......)))))).))).....))))....)))))))))))).(((....)))...((((.....))))....)))))...........(((((((((((............))))).))))))))))))))))))).....
Thermodynamic Ensemble Prediction
..(((((..(((((.(({{{(((((.((...)).))))).}}...(((((((((((((.(.((.{..(((.(((((((..,.......|{(((((((.{((((.(((((((((,((,(((((((.((((((((((((,.,((((((.......))))))}...(((.(((((.....))).))..)))((((...((((((..(((((.((.((.((((((.{(((..((((.....))))..)))).{({....,,.)))))))).))..)).))))))))))).)))).....(((((((.....(((((((((,{((((((((((((((((.{((,{(((.......{(((({..{((,,....|{...{|{{.{(,,,..,)).)}))...})...,)),.}.}))))},.,,)}}.,})),)),,,.}))))..)))))))))),})))))).....)))})}))...)))).....))))))))))).))).))).((((((((((((((...((.(((((..{.(((.({,((.((((.((((((((({....}))).))))))..)))))))).))).,.))))))))))))))))))))).)))))))))))))|(((((((((.(((((((((..(((((((((....)))))))))(((((....))))),((((((,...,||.}}}}|{|||{.,,{....,||,.........)))}||||||||,}},})),,.....)))))))},).))).))))))}....((((....))))...........))))))))...(((((((...))))))).))))))))))..}.)).).)))).(((((((.((.(((((((,((.((..((((((((((..(((.((,..{{{((((((..((((((((((..({,{{{.....{{,((((..((((,,(((.{.{.((.(((.,.,...(((((......{{(,..,...)}}(((((......)))))))))),|.,.))).})}}.)))))))).)))))))||||)))))))))).)))))),)}}}|||||..{{(({((({,,....,,,..,|||....,,}))))}))))),))|||,|||,,...)}}..)))))..))))).))))).)).)).(((((((.......)))))))....},))))))).))..))))))).))).))))))))))))))....)))))((((((.(((..(((((((.......))))))).))).))))))..{.(((((((.,.{{.(((((((((.((.((((.((((((((((((....))))).((((((.......((((.((((((((((((........(((((..{.((((((({...}))))))),|({(..((((((((((((...(((......)))...{{{,,|||||((.(({......})).))(({..{{{,||||,,...)))))}}.,}}|{|||...,,..,....,........,.|(((((((((((....,.......,{{{({...(((....)))...)))),{{..((((((((....((({...))))..))))))))..)}(((((((((({,((((...(((......))).....).))))))))..))))))(((((.(((((.,....}.)))))))))){((((...{{...((,{((((...)))))))}}..,))))).})))))))))))))))))))))).)))........(((((....)))))..)))))))))).)))))))}))),....)))).))))))))).)))))).)))))))))...}}.,.))))))).}...((((((((.(({{,((((((((....(((....)))..)))))))).,,,.,{{{,....,,)}.,.}).))))))))........(((({,((((((((..(((({..,(((((((((...{{(,.....))}.....))))).))))|((((((((((((.(((.((((...............((((((.........)))))).....{((((...))))}........({{{{.{(.....}}.)).))).....(((({((((((....))))))..}))))..{((((((....((((......))))))))))}||..,,))},.{(.((((((((.(((((((((.((((((..((((...,{{.......},,..))))....)))))).((((....)))).))))))))).)))))))).)))))).)))....))))).)))))))}...,,.{((((((((.(((....{(((,(((({.{((((..,,(((((.{(.({......{{,,,,.}|.,|,,.}),}}.})))))))}},||((((((,,,(({{{{,|||,,,,}}))}...(((((((((...........({((,|{{{.....))))...)}}}}}||||))},)))))}.}}}}}}.,,.......(((((.........)))))........((((.((....(({{{(.((((((.....((..(((((...(((((((((((((.{((,.,(((((,.,...({((((,((({.((((((.....))))))((((((.(((.(((((((((.............(((((((((((....{{({,.,....,.{{{{,......}}|}|...(((,....}}}{{(({...,,,|,},|(((.(((.(((((((((((((((((((((......)))))},(((((((......)))))))}......,|,((((.(({...}}})))}.))))))).....))))))))).))))))}..,|||,{{......)))))),.,...)))))}}))))))))),,))))...)))...))))))....,||,}}}},,......,|||........,)))}))))),....}})))}.},)))))))),..})))).)))))..)}......)))))).)))))....)).))))..((((((((((((((......((((.{{........((({,,{,,......))))))..}}.))))....))))..........))))))))))........{{{,....||},....,,|{(((.....,,}}}}}.{{{,.,{,,{{|,|{{,,,,)}}..}}}.}}}}},,,}}},,)}}}}}.,||,,...})))....)))))))))))),{{,....,||,.|(((({,{..,}}}.,)}))))),,,|......}|||{({{{{{{..........,.}}))),))))},))))))))))))).....

Transcripts

ID Sequence Length GC content
AAGAGGCAAGAGGUAGCAACAGCGAGCGUGCCGGUCGCUAGUCGCGGGU… 3384 nt 0.5334
Summary

This gene encodes a major glucose transporter in the mammalian blood-brain barrier. The encoded protein is found primarily in the cell membrane and on the cell surface, where it can also function as a receptor for human T-cell leukemia virus (HTLV) I and II. Mutations in this gene have been found in a family with paroxysmal exertion-induced dyskinesia. [provided by RefSeq, Apr 2013]

Forensic Context

A study in human autopsy tissue demonstrated that the SLC2A1 mRNA is upregulated in cardiac and skeletal muscle from individuals who died of asphyxia and in brain tissue from those who died of sudden cardiac death when expression data are normalized using a validated set of reference genes [Huth et al. DOI:10.1007/S00414-012-0787-2]. A study in humans demonstrated that mRNA quantification of the SLC2A1 in autopsy tissue specimens has diagnostic significance for investigating tissue ischemia/hypoxia and pathophysiological changes leading to death after injury [Zhao et al. DOI:10.1016/J.Forsciint.2007.12.004]. Forensic molecular pathology incorporates such omic analyses to visualize dynamic functional changes in the dying process, with the SLC2A1 being investigated for its role in tissue hypoxia/ischemia as part of an advanced molecular autopsy approach [Maeda et al. DOI:10.1016/J.Legalmed.2014.01.002].