| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACCUUUAUUUGCCGUCUUUCAACUGGCAAGAGUCAUUUUGACCAGCAGA… | 732 nt | 0.4740 |
Predicted to enable endopeptidase inhibitor activity. Predicted to be involved in cellular response to lipopolysaccharide; negative regulation of peptidase activity; and regulation of sensory perception of pain. Located in extracellular exosome. [provided by Alliance of Genome Resources, Jul 2025]
A study in humans identified the SMR3B as a novel absolute specific mRNA marker for saliva through transcriptomic sequencing of forensic body fluids [Liu et al. DOI:10.1007/s00414-023-03131-w]. A separate human study using targeted high-resolution mass spectrometry validated the SMR3B protein as a particularly reliable and robust marker for saliva identification, detecting it in all 50 saliva samples tested, including in aged and diluted casework-type samples [Brown et al. DOI:10.1021/acs.jproteome.5c00711].