Basic Information

Symbol
TBP
RNA class
mRNA
Alias
TATA-Box Binding Protein TFIID GTF2D1 TBP1 Transcription Initiation Factor TFIID TBP Subunit TATA Sequence-Binding Protein TATA-Box-Binding Protein TATA-Box Factor SCA17 TATA-Box Binding Protein N-Terminal Domain Spinocerebellar Ataxia 17 TATA-Binding Factor GTF2D HDL4 TF2D
Location (GRCh38)
Forensic tag(s)
Chronological age estimation

MANE select

Transcript ID
NM_003194.5
Sequence length
1857.0 nt
GC content
0.4658

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-561.8 kcal/mol
Thermodynamic ensemble
Free energy: -597 kcal/mol
Frequency: 0.0000
Diversity: 450.78
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((..((((((((((((((((.(..(((.(((((((.(((..((........))..))).)))))))..)))..).))))))))).(((...(((((.((((((((((.....(((.(((((.((.((((.....)))).))........((((((((((...(((...................))).....)))))))))).))))))))....))))))))))..)))))......)))............))))))))))))))((((.((((.((((..(((....))).)))).)...)))((....)).....((((((((..(.((((....)))))))))))))....((((((.(((((.(((((..(((.(((((((...((((((((((((((....(((((((((...........((.((.((.((.((.((.((.((..........)).)).)).)).)).)).)).)).(((((.((.((..(((.(((((((.....((((((..(((((.((.(((((.((.((((..((((((...((((.............)))).......((((.((.((.((((((..(...((.((...(((((((((..((((.((...(((.((((((((..(((((.((...((((.((.((((((((..((((..(((((((...(....)...))).))))..))))....((((((((((((((....)))))....(((((..(((((((((......)))))..)))).)))))...((((....))))..((((..............))))..))))))))).))))).))).......(((.........)))(((((...))))))))))).....)).)))))..))))....((((...((..(((((((.((((((...........))))))...........((((((.....))))))......)))))))))...))))((((...(((((((.((.(((..((((.((.....((((((((....)))))))))))))).)))..........(((.....((((((..(((.(((((((((((.(((........))).))))((((((...................))))))...((.(((.....((((((((....(((.............)))))))))))...))).)).((((.......))))...)))))))..)))....)))))).....)))....))...)))))))...))))............(((((((....))))))))))).)))...)).))))..)))))))))...)))).)..))))))..)))).))))..((((((((((((((((....((.(((.....)))))....)))).)))))))))))))).)))).))))...))))))))).)))))..)))))).......)))))))..))).)).)))))))..((((((......))))))........)))))))))......(((((((.(((.((((((.(((((....(((((((..((.......)).))).)))).....))))).)))))).))).)))))))..((((((((.(((((...))))).))))))))((((....))))))))))))))))))......(((...((((((......((((.....))))....))))))..)))......))))))).)))..)))))........))))))))))).....................))))...(((((.......)))))...............
Thermodynamic Ensemble Prediction
.(((((((..((((((((((((((((.({,(((.(((((((.(((..((........))..))).)))))))..))).}),))))))))}.(((...(((((.((((((((((.....(((.(((((.((.((((.....)))).))........((((((((((.,{(((...................))).,,..)))))))))).))))))))....))))))))))..)))))......)))............)))))))))))))){({{.((({.((((..(((....))).)))).}...))}((....}}.....((((((((..{.((((....))))}))))))))....((((((.(((((.{((((..(((.(((((((...((((((((((((((...,({(({(({(,..........{{.({.({.{{.{(.({.({.((....||....}}.||.||.||.||.||.||.||.||.||.||.||.}}.||,||{||{||,|,((((((..(((((.((.(((((.((.((((..((((,...,((((.,..{........)))}.||,...((({.((.((.((((((..(.{,((.((..,(((((((((..((((.((...(((.((((,,,,..{{{{{.{{{,.,,(({(..,,,||||,..((((..(((((((...{....)...})).))))..))))....((((((((((((({....}))))....(((((..(((((((((......)))))..)))).)))))...{(((.{{.,,,,..||||,.............}))}..))))))))).,},}}}))},,.,,|,(((.........)))(((((...})))),}}|||,....||,|||||,,||||{{,.(({{{,,{{,,{(({{{,.((((((,,.........))))}}.||,|,.,...((((((,...,))))))....||||||}}}}),,,}}}},{{{,.,((((((((((.,.,..,.,.,||.,,,,((((((({....)))))))))))),)))))},...,,,,.((({...{(((((({.(,,..,{||||||||,{,|}}}.,,,,}}}.,,,},|||||}||||||....{(((((({{{((((...,,.,((,{,..,,|||||,....}}}}}}}}))}})...,}})}}}}}}}....,..,,.((((.......))))..,})))}}}..}}}.,..))))))}..}})}},,.,},.}}}}..,.....,}},............(((((({....})))))})))).)))...)).))))..)))))))))...)))},)..))))))..)))),))||,,{(((((((((((((((....((.(((.....)))}).,..))))))))))))))))))),)))).))))...))))))))).)))))..)))))).......)))))))..,||{||{,,,,)))}}|(((((......)))))}........))))))))).,..{.{((((((.(((.((((((.(((((,.,,(((((((..((.......)).))).))))..,)}))))).)))))).))).))))))),.((((((((.(((((...))))).)))))))){{{,....,}}}))))))))))))))...,,,(((,..{{||||,,,...((({....,))}}....}}}}}}..,}}......))))))).)))..)))))........)))))))))))...........,,,......,))||{..(((({.......}))))..}},...}}},,..

Transcripts

ID Sequence Length GC content
AGUGAGGUCGGGCAGGUUCGCUGUGGCGGGCGCCUGGGCCGCCGGCUGU… 1655 nt 0.4634
AGUGAGGUCGGGCAGGUUCGCUGUGGCGGGCGCCUGGGCCGCCGGCUGU… 1857 nt 0.4658
Summary

Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes TBP, the TATA-binding protein. A distinctive feature of TBP is a long string of glutamines in the N-terminus. This region of the protein modulates the DNA binding activity of the C terminus, and modulation of DNA binding affects the rate of transcription complex formation and initiation of transcription. The number of CAG repeats encoding the polyglutamine tract is usually 25-42, and expansion of the number of repeats to 45-66 increases the length of the polyglutamine string and is associated with spinocerebellar ataxia 17, a neurodegenerative disorder classified as a polyglutamine disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2016]

Forensic Context

A study in a Chinese Han population demonstrated that the TBP was used as an internal reference gene for relative quantification via the dCq method in a SYBR qPCR assay for age estimation from peripheral blood [Deng et al. DOI:10.1016/j.legalmed.2021.101912]. A study in human post mortem cardiac and skeletal muscle tissues identified TATA box-binding protein (TBP) as one of the most stable endogenous reference genes for qPCR normalisation, alongside CYCA in cardiac muscle and SDHA in skeletal muscle [Koppelkamm et al. DOI:10.1007/S00414-010-0433-9]. Another study in human forensic autopsy cases validated TBP as a housekeeping gene for mRNA quantification in the myocardium, noting it showed partly lower correlation to other reference genes, had higher CT values indicating lower expression, and exhibited a significant postmortem decrease in some ventricular walls [Chen et al. DOI:10.1007/S00414-012-0732-4].