| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCUGCCUCUGAACUCCCUGGAGCAAGCACCUCCUGCUGGGCUGUGUGA… | 4266 nt | 0.5560 | |
| GCAGUAGCUGCCCGUGUCGGCAGCUGCAGCGGGUCGCACGGCUCCGGCC… | 4381 nt | 0.5663 |
This gene encodes a member of the PAR (proline and acidic amino acid-rich) subfamily of basic region/leucine zipper (bZIP) transcription factors. It is expressed in a broad range of cells and tissues in adult animals, however, during embryonic development, TEF expression appears to be restricted to the developing anterior pituitary gland, coincident with the appearance of thyroid-stimulating hormone, beta (TSHB). Indeed, TEF can bind to, and transactivate the TSHB promoter. It shows homology (in the functional domains) with other members of the PAR-bZIP subfamily of transcription factors, which include albumin D box-binding protein (DBP), human hepatic leukemia factor (HLF) and chicken vitellogenin gene-binding protein (VBP); VBP is considered the chicken homologue of TEF. Different members of the subfamily can readily form heterodimers, and share DNA-binding, and transcriptional regulatory properties. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
A study in mice demonstrated that the TEF is a key characteristic gene in endothelial cells and is markedly downregulated during myocardial infarction progression, as confirmed by scRNA-seq, microarray analysis, and in vivo experiments including qPCR, Western blot, and immunofluorescence [Mao et al. DOI: 10.1016/j.bbrc.2025.151820]. In a separate study in the Chinese Han population, the TEF was validated as a housekeeping gene marker that appeared in all tested body fluid and tissue samples, serving as a positive control in a multiplex mRNA profiling system for body fluid identification, although it showed low signals in saliva samples [Song et al. DOI: 10.1016/j.jflm.2015.08.006]. A study in mice demonstrated that the TEF is a key characteristic gene in endothelial cells and is markedly downregulated during the progression of myocardial infarction, as confirmed by single-cell RNA sequencing, independent microarray analysis, and in vivo validation via qPCR, western blotting, and immunofluorescence [Mao et al. DOI:10.1016/j.bbrc.2025.151820].