| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCACUUCCCAGAAGAGAAAACUCCUCCAAAAGCAGCUCUCACUAUCAG… | 1301 nt | 0.5473 | |
| AGCACUUCCCAGAAGAGAAAACUCCUCCAAAAGCAGCUCUCACUAUCAG… | 1182 nt | 0.5431 |
Bradykinin, a 9 aa peptide, is generated in pathophysiologic conditions such as inflammation, trauma, burns, shock, and allergy. The protein encoded by this gene belongs to the G-protein coupled receptor 1 family. Two types of G-protein coupled receptors have been found which bind bradykinin and mediate responses to these pathophysiologic conditions. The protein encoded by this gene is one of these receptors and is synthesized de novo following tissue injury. Receptor binding leads to an increase in the cytosolic calcium ion concentration, ultimately resulting in chronic and acute inflammatory responses. [provided by RefSeq, Aug 2020]
A study in humans demonstrated that major blunt trauma triggers a selective and sustained upregulation of the BDKRB1 in circulating leukocytes, with its expression being among the top five up-regulated genes at various time points over 28 days post-injury [Brandfellner et al. DOI:10.1097/SHK.0b013e31829de02f]. Another human study investigating salivary extracellular vesicles found the BDKRB1 was significantly upregulated in patients from an outpatient concussion clinic compared to healthy controls, and its expression was higher in these chronic patients than in acute emergency department patients, indicating its role in the inflammatory response to head trauma [Cheng et al. DOI:10.4103/1673-5374.266924].