Basic Information

Symbol
TGM4
RNA class
mRNA
Alias
Transglutaminase 4 TGP Protein-Glutamine Gamma-Glutamyltransferase 4 Prostate-Specific Transglutaminase Transglutaminase 4 (Prostate) Prostate Transglutaminase Transglutaminase P Fibrinoligase EC 2.3.2.13 TGase P TGase-4 TG(P) Transglutaminase-4 HTGP
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_003241.4
Sequence length
3391.0 nt
GC content
0.4981

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1108.80 kcal/mol
Thermodynamic ensemble
Free energy: -1163.70 kcal/mol
Frequency: 0.0000
Diversity: 875.56
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((.((((((((((.((.....)).)).....((((.((((.((((......)))).)))).)))).(((((((..((((((((.....((((((........((((..(((((((((((((((((((...((((((((((.(((....))))))....))))).)).)))))).)))).((..((((((((((...)))))).(((((((.....))))))).......)))).)).....(((((.......)))))....(((.(((......(((((((((.........)))))))))))).)))((((....)))).............((.(((((...............))))).)))))))))))..)))).......)))))).....))).)))))((((((((...........((((.....(((((((((..(((((.....((((((.................))))))(((...))).....)))))..))))))))).......((((((.(.((.......)).).))))))....))))((((.((((...)))).)))).((((..((((...)))).....)))).....(((((((.(((((.......((((((((.(((.....(((((.(((.(((.(.(((......))).).))).))).)))))...((((((..(((.(((((...((((((((((((((..((((((((...(((((.(((((((.((((((((..(((((((((((((((.((..(((((.(((((((....))))...))).))))).((.((((((..(((((((......(((((((.......)))))))...)))))))(((((((((((((((((((((......(((...))))))))).)))))))))((((((.((.((((((((.(((((((((.((.((((.(..((((..(((((..((...))..))))).......(((.((.....)).))).......(((.(((...))))))...)))).).))))..)))).).)))))))))))..(((.....(((....))).....)))))).)).)))))).....)))))))))))).))(((((((((((.....(((((..(((..(((....)))..)))..........(((((.(((((..(((((((..(((((..((((((..(.((((.(.(..((....))..).).)))))..))))))..))))).))))))).))))))))))....(((((((((.(((.(((((.((((((((.................(((((((((((......)))...((((.(((((...((((.((((((.(((((....(((((...)))))(((((((((...)))).)))))..((((((((((....))))))))))......((((.(((..(((((....))))).))).))))(((((.((....)))))))..)))))..))).)))....))))..)))))))))..........))))))))................(((((((.(((((((((.((((((((((....((((((.((.((((.....(.(((((..((.....))..))))).)((((((((((.(..(((....)))..)))))))))))......................((((((.((((....))))))))))((((.(((((.((((....((((((((.((((((..((..(((..........)))..))..))))))..))))).)))...)))).)))))))))..((((((.....)))))).....)))).)).))))))))))))))))..))))))....(((.(((..(((.((((((....))))))........)))..))).)))....((((.....(((....))).....)))).((((((...(((.((..........))))).......))))))............))))))))))((((((.(.....).))))))........((((..((((.((((.((....)))))).)))).))))((((....)))))))))))))))))...))).))))))))).))))).....))))))).))))(((((...((((((...(((.(((((((..((........(((((((((..((((((..(((((((......((((.............................))))((((((((((....))))))...))))......(((((((......((((((((((((...................((((.((((((((.........))))))....)).)))).((((((((....))))).)))......(((((((.((..((.((((((((.((.(((.((.....(((((.(((((((((((..(((((((((((.((((....(((((((.(.(((.....)))).)))))))((((((.......)).))))......((((((((((.(((.((((((((((.(((............))))).............))))))((((.....)))).)).)))..))))))))))....((((.(((.....))).))))..)).)))))))))))))(..((((((....(((.....((((....)))).))).....))))))..)......)))))))...))))..)))))......)).))).)).)))...))))).))..)))))))))(((((((.((((...)))).)))))))(((.(((..((......))..)))))).........))))..)))..)))))......)))))))..)))))))..)))))).))))))))))).))))))).))).))))))...)))))...........(((......)))...)).)))))))))).)))))..)))........))))).))).......)))).))))).......(((.(..(((((((((.((.((....)).))..)))))))))...).)))...((((.(((((......(((((......)))))...))))).))))))))))))..))))).......))).))))))))))))))..))))))((((((......))))))...((((.......))))((((((.((.((((((........))))))..)).))))))))).)))).)).)).......)))))..)))))))..)))))))).........)))))))..)))))))).))).((((((((....)))))))).....
Thermodynamic Ensemble Prediction
(((.(((((((({{.((.....)).}}.....{(((.((((.((((......)))).)))).)))}.(((((((.,((((((((.....((((((...,....((((..((((((((({{{,(((({{...((({{(((((.(({.,,,||||||,,,.}}}}),)).}))))),))}}.||.|||||{(((((...}})))){((((,(({{{{{|||||,,.....................,...})))..}))))}}}..|})}}...,{.((((((((((.........)))))))))).}.,,,((((....)))).|...........((.(((((.............,.))))).)))))))))))..))))..,....)))))).....}))}|}}}}((((((((,.,,..,....,((,....,(((((((((..(((((.....((((((.................)))))}{((...))).....)))))..))))))))).{{{{{.((((((.(.((.......)).).))))))....,.})|||{.((({...})||{||||((({(,,((.{{,...},....,,))}.}}}}))),|||,{{({(.......(({(((((.(((,....(((((.(((.(((.(.(((......))).}.))).))).)))))...{(((((..(((.(((((...(((((((((((((.{(((((((((...(((((.(((((((.((((((((..(((((((((((((({..((.(((((.(((((((....))))...))).))))))),.{(((((..(((((((......(((((((.,...,.))))))),..)))))))((((({(((((((((((((((......{{{...})))))))).)))))))))((((((.((.((((((((.{(((((({{.((.((((.,..((({..(({({,,((,,,,},.}|||,.,.,...(((.((.....)).)))...,.,.{||,|{{...)))))),..)))).}.))))..)))).)}}))))))))))..(((.....(((....))).....)))))).)).)))))).....}))))))))))},|,(((((((((((.{{{{((((,..,(({{((..{{{{{{{{{{{..,{,,...||{((({,,,,...||||,,{,.(((((..((((.(({(..,|}}}}}}}||}}}.))}}).,.,,}))}})))).,}})))),.,,,))))))))|||,,,,..,.{((((((((.{((.((((,,((((((((..............{{{((({,((((((......))),{.((,,.,||,|}..((((,(({{{{.{(({{.,{{((({{,{{|||||(((((((((...)))).))))),,((((((((((....)))))))))).,{,{.{{{{,|||..{((((,,,.|}}}}.}}}.|}||((((,,((....)))))))|||||||{,||,.||,..,|||||,,|||||||||...,|||...,}}},|||{...{{,,{{....}}|||,|||}|||||{(({.((((((((({....((((((.{(.{({{....|{|(((((..((.....))..})))}|,((((((((({{(..(((....)))..))))))))))).|,...{{,,,.........,.((((((.{(({....}))})))))),,,,.{{{||,|{||,..,|||{{{{{.|||||{,,||..|||..,,,,,,..}}),,)),.}}))})..))))),)))...}))),))}}}},}|,,{(((((.....)))))}...,,||||,}}.||||}}|||}}}})))..}}))))....{{|,|||},||,.{{((((....)))))).,}}},.,)))..))),|||,{{{(({({{,,.(((....)))....{||||,((((((...(((,({..........))})).......)))))).........,,|}|||,}},|,,,{{{,.{,,,.,)}),,))),},....,||||..||||.,,{|,||},,.,})))),)))).)},)||,,..}})))))))))))))))))...))}.))))))))}.},},,.....))))))).)))){||{(.,.{{{{{{,,.(((,(({((((,,,{........(((((((((..((((((..(((((((.....,(,..,,,,.......{(((((((..........,(((((({((((((....))))))}...,,|,.......{,{||,.....{{{,.((({,{{{,{{,..............((((.((((((({,........))))))....)).)))).{(((((((....))))).))}......(((((((,((..((.((((((((.((.(((.((.....(((((.((((((((((({.(((((((((((.((((....(((((((.,.(((.....)))}.)))))))|||((........))((((({.....}))))}((((((((...({,(((((.(((............)))},...,}}}......))))))}},{....{(((({,|...,..))))))||,|{{..((((.(((.....))).))))..)),))))))))))))),,.((,(((,,,,,{(.{,..((((....)))).}))..,,,,,},,,}})..,,.,)))))))...))))..)))))......)).))).)).)))...))))).))..))))))))|(((((((.((((...)))).)))))))}})}|..}}}......{||....},,.,,.....})))))...,,..)))))))}.}}))..)),..)))))))..)))))).))))))))),,.}}}}}}}.))).))))))...))))}...........{{{......}}}....},}))))))))).)))))..}})........))))).))).......)))).))))).......(((.{..(((((((((.{(.((....)}.))..)))))))))...}.)))...((((.(((((......(((((......)))))...))))).))))))))))))})))))).......))).))))))))))))))..)))))|((((((......)))))}...((((.......))))((((((.((.((((((.,....,.))))))..)).))))))})).)))),,).)).......))))}..,)))),,,.)))))))).,,,,,}},)))))))..)))))))).))).((((((((....)))))))).....

Transcripts

ID Sequence Length GC content
ACCGACUGUGUGGAAGCACCAGGCAUCAGAGAUAGAGUCUUCCCUGGCA… 3391 nt 0.4981
Summary

Predicted to enable protein-glutamine gamma-glutamyltransferase activity. Predicted to act upstream of or within mating plug formation. Located in Golgi apparatus and collagen-containing extracellular matrix. [provided by Alliance of Genome Resources, Apr 2025]

Forensic Context

A study in humans developed a reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for semen identification using the TGM4 mRNA marker, demonstrating marker-specific amplification with no cross-reaction with other body fluids and a detection limit of 30 nL of semen [Satoh et al. DOI:10.1007/s00216-018-1088-5]. Further research in humans investigated quantitative trait loci (QTLs) for the TGM4 gene, identifying 251 expression QTLs (eQTLs) and 247 splicing QTLs (sQTLs) in prostate tissue, with massively parallel sequencing validation on semen samples from three donors confirming allele-specific dropout for eQTL alleles with negative normalized effect sizes [Van Den Berge & Sijen DOI:10.1016/J.Fsigen.2026.103423]. A study in humans demonstrated that the TGM4 is a highly sensitive and specific mRNA marker for semen identification [Xu et al. DOI:10.1371/journal.pone.0100123]. Further research in a Chinese Han population confirmed the TGM4's high specificity for semen and its expression in prostate and testes tissues, validating its inclusion in a multiplex mRNA profiling system for forensic casework [Song et al. DOI:10.1016/j.jflm.2015.08.006].