| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCAGACGCUCCCUCAGCAAGGACAGCAGAGGACCAGCUAAGAGGGAGA… | 1678 nt | 0.5429 |
This gene encodes a multifunctional proinflammatory cytokine that belongs to the tumor necrosis factor (TNF) superfamily. This cytokine is mainly secreted by macrophages. It can bind to, and thus functions through its receptors TNFRSF1A/TNFR1 and TNFRSF1B/TNFBR. This cytokine is involved in the regulation of a wide spectrum of biological processes including cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation. This cytokine has been implicated in a variety of diseases, including autoimmune diseases, insulin resistance, psoriasis, rheumatoid arthritis ankylosing spondylitis, tuberculosis, autosomal dominant polycystic kidney disease, and cancer. Mutations in this gene affect susceptibility to cerebral malaria, septic shock, and Alzheimer disease. Knockout studies in mice also suggested the neuroprotective function of this cytokine. [provided by RefSeq, Aug 2020]
A study in human skin wounds demonstrated that the TNF is up-regulated at injury sites and is available for the determination of wounds aged 30–90 minutes based on staining intensity in keratinocytes and sweat glands [Kondo et al. DOI:10.1016/J.Forsciint.2010.07.004].