Basic Information

Symbol
TNF
RNA class
mRNA
Alias
Tumor Necrosis Factor TNF-Alpha TNFSF2 TNFA DIF Tumor Necrosis Factor Ligand Superfamily Member 2 TNF-A Tumor Necrosis Factor (TNF Superfamily, Member 2) Tumor Necrosis Factor Ligand 1F Tumor Necrosis Factor-Alpha Tumor Necrotic Factor Alpha TNF Superfamily, Member 2 TNF, Macrophage-Derived TNF, Monocyte-Derived APC1 Protein Cachectin IMD127 TNLG1F
Location (GRCh38)
Forensic tag(s)
Wound age identification

MANE select

Transcript ID
NM_000594.4
Sequence length
1678.0 nt
GC content
0.5429

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-600.20 kcal/mol
Thermodynamic ensemble
Free energy: -630.21 kcal/mol
Frequency: 0.0000
Diversity: 311.64
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((((((((......((..((((((((..((((..((((((((((((.(...............((((.........))))...........((((.((...)).))))..).)))))))))))).........((((.(((((((..(((.(((.....))).)))....((((((...((.((((((((....(((.(.(((((((((((((((((.(((((((.........)))))))((((((..((.(((.((((((((((((((((((((((((.......(((.(((((.((((((((((.(((..(((...(((((((...(((.((....((((...((((((.((((.(((....))).))))..........))))))))))(((((.((((.........((((.....))))))))..)))))..)))))...)))))))..((((((...)))))).((((((((..(((......)))((((....)))).....(((...))).))))))))..))).....)))))))))))))...((((((((((...............))))))))))...(((((((.((.((......)).)).)).)).)))..............))))))))(((((((......))))...)))....((((.(((((.((...........)).))))))))).....))))))))))))))..(((((((.(..((((((...........(((((((((....(..((((..((((((..(((((.(((((((......))))).(((.....))).....)).))))).(((((((.....(((((((...(((...(((..(.....)..)))..)))...))))))).......)))))))...........)))))).))))..))))).)))))..........))))))..........).))))))).((((....))))..((((((....))))))))))))..)))).))).))..))))))..(((((...(((..(((.((((......)))).)))...))).......(((((((((((((.((((......))))))))).))).)))))..)))))..(((((((((((((((..(((((((((..(((((..............((((...((((.....))))))).)..............)))))..))).)))))).)))))))))...))))))))))))))......((.((...))))(((....))))))))))))))))..)))))))).))))))))..................................((((((((....)))))))))))).))))))).....(((((.....(((..(((((.((((((..((((...(((((((...)))))))...)))).))..)))).))))))))....))))).(((......))).......(((.((((((....))))))..))).(((((.(((((....)))))..))))).((((((.....))))))....))))..))))))))..)).)))))))...))))))..(((((((.......)).)))))..........................
Thermodynamic Ensemble Prediction
.(((((((({((((,.{,..((..{(((((((.,((((..((((((((((((.(.......,.......((({.........}}}}...........{{{{.,....|}.}})),.).)))))))))))).........((((.(((((((..(((.{{(,,...))).)))....((((((...((.{(((((((....(((.(.((((((((((.{(((((((((((((.........)))))))....(((((((.(((((((({((((.((((({,(({.,{(.{(((.,{..((((((((((,......,,.....,)))))))))..,,.)))).)}..((({.,{((((((.((((.(((....))).))))..........))))))))}}(((((.((((.........((((.....))))))))..))))){((({,,,..{(.(((...((((({...})))))...))).)))})))))...{((({(((((..,......}))))..})))).))))))))).))))}...((((((((((.....((((((((((...............))))))))))...{((((((.((.((......)).)).)).)).)}}......)))))))))).))))))))(((({.....}|}}...((((,.(((.,((({{((....{(((,(((((.((((((((....))){{(,,(((((.{.((((.....)))).}.))))).))).))))).))))))))}...)).)))),,))|}))))(((((.((({(((,,,...|||}}.|||..,,,))).....)).))))).(((((((....,(((((((,{{(......}}}}({,({.....,.}})..,..))))))).,.....)))))))..{{{{{.........{{..{{{{.{|...(((((((.(((((.{......,.}))))..)))))))}}.}|||,.}}.,,,,..((((({....}))))).....,.........,......,,)))}}|((((...({({.(((.((((......)))).))).,,)))...,...(((((((((((((.((((......))))))))).))).)))))..}))}}..(((((((((((((((..(((((((((..(((((,{{,,,,....}},,(((...((((.....))))))).,...,}....,..,,)))))..)))},))))).))))))))}..,))))))..,,...)))}}..))))))).)})))))...}.).)))))))))))))..)))))))}.)))))))).........,,..,,..,,..,..||..,.....((||||||,,..,}))}})))))).))))))).....(((((.,...(((..(((((.((((,,..((((...(((((((...)))))))..,)))).),..)))).)))))))),..,))))).|||,..,,,))).......(((.((((({....))))))..))).{((((.(((((....)))))..))))},((((((.....))))),,,..)))).,))))))))}}|,.))))))}.,}))))))..((((({,,,,....)),))))).............,,...........

Transcripts

ID Sequence Length GC content
AGCAGACGCUCCCUCAGCAAGGACAGCAGAGGACCAGCUAAGAGGGAGA… 1678 nt 0.5429
Summary

This gene encodes a multifunctional proinflammatory cytokine that belongs to the tumor necrosis factor (TNF) superfamily. This cytokine is mainly secreted by macrophages. It can bind to, and thus functions through its receptors TNFRSF1A/TNFR1 and TNFRSF1B/TNFBR. This cytokine is involved in the regulation of a wide spectrum of biological processes including cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation. This cytokine has been implicated in a variety of diseases, including autoimmune diseases, insulin resistance, psoriasis, rheumatoid arthritis ankylosing spondylitis, tuberculosis, autosomal dominant polycystic kidney disease, and cancer. Mutations in this gene affect susceptibility to cerebral malaria, septic shock, and Alzheimer disease. Knockout studies in mice also suggested the neuroprotective function of this cytokine. [provided by RefSeq, Aug 2020]

Forensic Context

A study in human skin wounds demonstrated that the TNF is up-regulated at injury sites and is available for the determination of wounds aged 30–90 minutes based on staining intensity in keratinocytes and sweat glands [Kondo et al. DOI:10.1016/J.Forsciint.2010.07.004].