Basic Information

Symbol
BMI1
RNA class
mRNA
Alias
BMI1 Proto-Oncogene, Polycomb Ring Finger RNF51 PCGF4 Polycomb Group RING Finger Protein 4 Polycomb Complex Protein BMI-1 B Lymphoma Mo-MLV Insertion Region 1 Homolog (Mouse) Murine Leukemia Viral (Bmi-1) Oncogene Homolog B Lymphoma Mo-MLV Insertion Region 1 Homolog BMI1 Polycomb Ring Finger Proto-Oncogene BMI1 Polycomb Ring Finger Oncogene Polycomb Group Ring Finger 4 Polycomb Group Protein Bmi1 Ring Finger Protein 51 RING Finger Protein 51 Flvi-2/Bmi-1 FLVI2/BMI1
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_005180.9
Sequence length
3540.0 nt
GC content
0.4011

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-964.00 kcal/mol
Thermodynamic ensemble
Free energy: -1035.35 kcal/mol
Frequency: 0.0000
Diversity: 866.35
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((.(((.(((((((((((((.(......).)))((((((((((.(((((((((((((((.((.((((.(((........((((.....))))....((((((((((......(((((((.....)))))))....((........))((((((.((...(((...((((((.(((((((....(((.(......).)))..))))).))))))))........))).)).))))))((((((((.((........)).)))))))).))).)))))))))))))).)).)).))))).))))))))....))))).))))))))))))))).)))..))))))(((((((.((..((((((((((((......)))(((((((.((((((((((((((((.(((((..((((((.((((.(((((...((((.(((.(((((...((((.((....)).))))...).)))).))).)))).))))).)))).....))))))))))).)).)))..))))))))....(((..............)))....)))..)))))))...)))))).)))..)).))))))).(((.(((....((((((((...((((.((((.(((((((((...(((((..(((...............(((((((.((...((((((....))))))....))))))..))).((((((.(........).)))))).....(((((.(((.(((((....((((..(((((((((.((((....(((.((((((((.(((.((((.((((((.....((((........))))..................(((((((......((((((....(((((((.........))))))).....))))))..)))))))((((((.(((..(((((((((((((((((....(((((((((.((((((((((((.(((((..((((.....)))).(((((((((..(((((.....)))))..((((..((((((..(((((.(((((((...((.................(((....)))...((((((((((.((((...(((.((((.(..(((...((((......))))...))).....).)))).)))..(((((.....((((((.(((.....(((((((...(((((..(((((((.......(((....)))....))))))).....((......)).))))).....)))))))))).)).)))))))))((((....((((.(((.......)))))))....))))...)))).))))).(((((..((((((.(....(((((((.(((((...((.((((...)))).)).((((.(((((...((..(((((.....)))))..))....))))).))))....))))).)))))))))))))).))).)).......))))).....((((..........))))(((.((..........)))))..)).)))))))..))))).))).)))..))))..))))))))).......))))).))))))))))))(((....)))...........(((................)))............)))))))))))))))...((((((((((.(((((((((((((......(((((........(((((((((((.(.........).)))))))))))))))))))))))............((((.(((((.........))))).)))).......)))))).)).)))))))).))))(((.......))))))))))))).)))))).(((((((.....))))))))))))).))))))).).........)))))))..)))..)))).))).))))))..))))...)))))...))).))))).)))..)))))))))))))).......((((((.((......)).)))))).((((((((((((((.................))))...((((((((((.....))))))))))(((((((((((((((....(((((((((.........(((((((.(((((...(((((((............((((...))))....))))))).(((((((((..(((.((..((((((.(((.......((((((......))))))....))).)).))))..)).))))))))))))....))))))))))))....(((((((((((..((((((...))))))(((((((((((((....((((((.(((((.....)))))))))))((((((.(((((((((((((.((((....((((((.((((((.((((.(((((((.(((((((((...(((((.............(((((....(((((....)))))........(((((((.(((((.((........))..))))))))))))(((((((.((....................((((.......))))......(((((.((.((((((((((.((((((((......)))).))))((((.(((((...............(((((((....)))))))((((((((.((((((...))))))))))))))..))))).))))..)))))))))).)).)))))..)).)))))))...(((((((((....((((..((((........(.((..(.(((((...(((((....))))).))))).)..)).)))))..))))..))))))))).((((.(((.((((((((((((((..(....)..))))))))......)))))).))).))))..((((((........))))))............)))))...............)))))...))))))))).((((......))))((((.(((........))))))).........(((((((......)))))))..)).))))).)))).)))).)).))))))((((....)))).))))...)))))))))...)))).)))))))))).)))).))))).....(((.((((((.(((((..((((((.(((((.((.(((((((.........))))))).)).....))))).))......((((((((((((((..((.((.(((...((((((...))))))...))).((((((((((((((((.(((......)))))))))))))))))))..((((........)))).(((.....)))........)).))...)))))))))...)))))...))))..))))).)))))).))).....(((....)))..))))))))))).........)))))...)))).....)))))))))))))))))))))))))....)))).))))...)))))))))))))).((.(((((((((..........)))).))))).))(((((.(((...))).)))))...
Thermodynamic Ensemble Prediction
.{{((((.(((.(((((((((((((.,......|.}}}((((((((((.(((((((((((((,({((.,(((.((,.......,||||....,||||{({{((((((((((....,,(((((((.....))))))).}}.{.{{,...,,||(({{{{.{,...((((,.(({(((.(({{(((,,..,,...}||},.,.,)).,)))}).})))))}}........)))})).))))}}((((((((.((........)).)))))))).))).)))))))))))))).)).)).))))).))))))))....))))).)))))}))))))))).)))..))))))(((((((,((..((((((((((((.,.,,.|||(((((((.((((((((((((({((.(((({..((((((,((((.(((((...((((.(((.((((,{{,((((.((....)).))))..,)})))).))).)))).))))).)))}...,.))))))))))).)).)))..}))))))),,,.(((..............))).,,})))..)))))))...)))))),))),,)).)))}}})}(((.{{{....((((((((...((((.((({.(((((((((...(((((..(((..............,{{{((((.((,{.((((((....)))))).}}.)))))}..,,,.{{{((({(....,}}}).}}}}}}.....(((((.(((.(((((..,.((((..(((((((({.((((....(((.(((((((,.(((.((({.((((((.,,,,{((,{{{{,,.{||||,......}|}....}},.||||||,,|...,|||(((....(((((({.........}}}||||,{|{{|}}}},..,,,|||{((((,{.,,,.,,|||{|||||{((((((....(((((((((.((((((((((((.(((((..{{,,.....}}}}.((((((((({.(((((.....)))))}.((((..((({((..(((((.(((((((...((...,,.........,..(((....)))..,((((((((((.((((...{({.{(((.,,.(((...((((......))))...))),.,..).}})).))}..{{{{,....{(((({{.(((.....(((((((.,.(((({..{((((((,,,....(({....}}).,,.}})}})}.....|{......)),})))).,,..)))))))))).}},}))))|||}((((....(((({(((.......)))))))....)))),,,)))).))))).{{({(..((((((.{....(((((((.(((((...((.((((...)))).)).((((.(((((...((..(((((.....)))))..))....))))).))))....))))).)))))))))))))).))).}}.......))))).,..|((((..........))))|{{.((....,,....)))))..)).)))))))..))))).}}}.)))..))))..))))))))).......))))).))))))))))))(((....))).....,,,{,,{{(................}}},,,......,,.)))))))))))))))...((((((((((.(((((((((((((......(((((........(((((((((((.{.,.......).))))))))))))))))))))))),....,,.,,,,{(((.(((((.........))))).)))),,,..,.)))))).))}}))))))).)}}},,,,,,}}}})}}}}}))}))))})}}))),(((((((.....))))))))))))).})))))).},,,......)))))))..))).,)))}.))}.})))))..))))...)))))...))).))))).)))..)))))))))))))).......((((((.((......)).)))))).((((((((({.,{{,,...||.......,},}}},...{(((((((((.....)))))))))|(((((((((((((((....(((((((({{{,,,....(((({{{((((((.,.{(((({{............((((...)))}....))}}}}|.(((((((((..(((.,(..((((((.(((.......((((((......))))))....))).)).))))..),.)))))))))))).,..))))))))))))..,.{((((((((({..((((({...}))))){{{{{{{{|{{{{{...((((((.(((((.....))))})))))),(((((.,{{((((((((((.((((..,.((((((.,{((((.((((.(((((,{.(((((((((...(((((.....,,,..,,.{({((.{{,{((({....))))},}.....{(((((((.(((((.((........))..))))))))))))}|{,,{{|||.........,.,,....,,,{{{{.......)))},.....(((((.((,((((((((((.((((((((......)))),})))((((.(((((..............,(((((({....})))))){((((((,{((((({...}))))))))))))}..))))).))))..)))))))))),)),))))),||||}}}}}},...(((((((((....((((..((({.......,{.((..{.(((((,.,(((({....}}))),))))).},,)).}))))..))))..))))))))).||||.{{{{(({{{{((((((((..{....)..)))))))}..,|||||||||{||,.||||..,,||||..}}}}}}))}}}}............,,,,..,,,,,}}.......)))))...))))))))).|||(,{....}},(((((.(((........))))))))....,...(((((((,.....}))))))..}},))))).)))}.)))).,,.)))))),{{{....})),.))))...)))))))))}..}}},.))))}}}}}).)))).)}))}.....(({.{(((((.({(((,.({({{{.{{{((,{{.{{(((((..,,,,,..))))))),)},,.,,))})}.,||{|{{{,{,{{{{{|{||||,,|,....,{{...((((((...))))))...}}}.((((((((((((((((.{({......})}))))))))))))))))..((((........)))).,,,,,,{{|,......}},},.,,.,.,,,,,,,,},,,},}}},..})))..))))),)))))).}))}....(({....)))..}}))))))))}...||,...}}}},...}))}.},..)))))))))))))))))))))))))..}.)))).))))...}))))))))))))).{(.((((({{{{.,,,,.....})))}))))).)}{{{{,.,||,,.,,,.}}})),..

Transcripts

ID Sequence Length GC content
AGUUUCCACUCUGCCUUCAGCGGUGCAUUUUUUUCCACCCUCCCCUCCC… 3540 nt 0.4011
Summary

This gene encodes a ring finger protein that is major component of the polycomb group complex 1 (PRC1). This complex functions through chromatin remodeling as an essential epigenetic repressor of multiple regulatory genes involved in embryonic development and self-renewal in somatic stem cells. This protein also plays a central role in DNA damage repair. This gene is an oncogene and aberrant expression is associated with numerous cancers and is associated with resistance to certain chemotherapies. A pseudogene of this gene is found on chromosome X. Read-through transcription also exists between this gene and the upstream COMM domain containing 3 (COMMD3) gene. [provided by RefSeq, Sep 2015]

Forensic Context

No relevant information is available at the moment.