| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCCUUCCCUGUCUCUGCCUCUCCCUCCCUUCCUCAGGCAUCAGAGCGG… | 1626 nt | 0.5947 |
The protein encoded by this gene functions in part as an adhesive glycoprotein. Differential expression of this protein can promote either cell adhesion or migration as it links cells to the extracellular matrix through a variety of ligands. These ligands include integrins, plasminogen activator inhibitor-1, and urokinase plasminogen activator receptor. This secreted protein can be present in the plasma as a monomer or dimer and forms a multimer in the extracellular matrix of several tissues. This protein also inhibits the membrane-damaging effect of the terminal cytolytic complement pathway and binds to several serpin serine protease inhibitors. This protein can also promote extracellular matrix degradation and thus plays a role in tumorigenesis. It is involved in a variety of other biological processes such as the regulation of the coagulation pathway, wound healing, and tissue remodeling. The heparin-binding domain of this protein give it anti-microbial properties. It is also a lipid binding protein that forms a principal component of high density lipoprotein. [provided by RefSeq, Aug 2020]
A study in mice demonstrated that perinatal lead (Pb) exposure altered adult hippocampal gene expression, where the VTN was identified as a cell cluster marker for pericytes [Bakulski et al. DOI:10.1093/toxsci/kfaa069]. In human forensic research, the VTN mRNA was validated as a specific marker for liver tissue identification within a multiplex assay designed to infer organ origin from crime scene samples, showing high specificity and sensitivity in profiling degraded specimens [Lindenbergh et al. DOI:10.1007/s00414-013-0895-7].