Basic Information

Symbol
VTN
RNA class
mRNA
Alias
Vitronectin VN Serum Spreading Factor Complement S-Protein Somatomedin B V75 Vitronectin (Serum Spreading Factor, Somatomedin B, Complement S-Protein) Serum-Spreading Factor S-Protein Epibolin VNT
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_000638.4
Sequence length
1626.0 nt
GC content
0.5947

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-646.2 kcal/mol
Thermodynamic ensemble
Free energy: -676.23 kcal/mol
Frequency: 0.0000
Diversity: 421.66
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((....((((((((.(((.....(((.....)))....)))))))))))...))))))..(((.(((..........))).)))(((((((((((((((((.(((.....(((((.....))))).....)))....))))).)))))..)))))))((((..(((((((....((((((.(((((((.(.(((((...........))))).)))))))).))(((((((..........)))))))..(((((((.((....))))..))))).))))...)))))))((((((..((((..(((...((...))...))))))).(((...)))(((((.((((((............(((((((.((........((((((..(((((((..........((((((((.((((...(((....)))((((((....)))))).....(((.(((.((((((.(((((.......))))).))))))...))).))).....))))...)))))).)).........)))))))......)))))).(((((((.((((((((....((((((((........).)))).))).........)))))))).)))))))....)).)))))))...((((((..(((((((....((..(((((.(.((((...)))).))))))))....)))))))((((..(((((((.((((((.(((((........)).......((((((((((((......)))))..((((((((((..(.((((((........)))).)).)....)))))))))).........)))))))))).))))))((((((((.....)).))))))......)))))))..))))))))))(((((((((((((((((((....(((((...))))).....((.((((((.......)))))).))((((((((((((((((((((((((.((((((.......)))))).))..........((((((..((.((((((..(((((..(((..(((..(((...)))...((((((........(((((....))).))))))))(((((((.(((....(((((((...)))))))))).)))))))((.(((((((((((((..............)))..(((.....)))...(((.((((..........)))).)))....((....))...((((..((((...)))).)))).)))))))))).))....)))..)))..)))))..))))))))..)))))).....(((((((((.....)))))))))...(((((.((.((....)).))..((((((.(((.(.(((....))).))))))))))......((((.((((((((((((......)))))...........((.....))(((((.....))))).))))))).))))..)))))....)))))))).))........))))))))))))))).))))))))))).)))))(((((((((((((........))))..))))..))))))))))))))))......)))).))........))))............
Thermodynamic Ensemble Prediction
.,,,{(((((((((((({{(((.....({{.....}))....)))))))))))...)))))).{((({(({.,{{,{{{,,|||,,}}|||{,{,{(((((((({.{((.....(((((.....)))))....,)}}.,,,))))).))))}}})))))}}({{{..(((((((....((((((.{((((((.(.(((((...........))))).)))))))}.))(((((((..........)))))))..((((({{.({....)))),.))))).))))...))))))){{((((,,((({.,({(...{{,..)}.,,}}}})})}({{...)))(((((.((((((............(((((((.{{...,{{{,((((({..(((((((...,,,{.,{((((((((.{{((,..(((....|}}((((((....)))))).,...|||.{||.((((((,(({((......,))))).))))))..,))),})),,.,.))}}...)))}))|}..,,......}))))))......)))))}.(((((((.((((((((...(((((((((........),}))).))}.,,,.....)))))))).))))))),,..}}.)))))))...((((((...,.........(((((.(((((({(((...)))).(((((((((.(.(((((((((((((((((,{{.,.,,(({((,{.........))}}}..,{((((((((((((......)))))..((((((((((..(.((((((........))))})}.),...)))))))))).........))))))))))))))))),|.|}))))))).).)))))).)))...))))))).)))))))))))(((((((((((((((((((,.,.((({{...,},))}....{{,((((((.....}.)))))).,,((((((((((((..{(((((((((.((((((.......)))))).))}..)))))},((((((..((.((((((..(((((..(((..{{{.,(,({,.,,,..(((((((,{....,|||||{....))),,,))))))|{{,.{,,((({{{{,{(((,{{{,|||||}|{{,..{((({.((.(((({{,{||||,},.}}},,..,,,.)))..|||,,,..)))..,|||,|||,...,,,,...|}|,..|||...((....))...||||..{(((...,})}.||||{|,,,,)))))}})..,,}))..)))..)))))..))))))))..)))))).{(.(((({{((((((.((((((({|,{(({,(({,.{{.{,....}}.}}..((((((.(((.(.(((....))).))))))))))......})}.})))|,,}})}}))}}.))))))))))).}}...{(({......}}||,,,..{||{|,((((...(((((...........))))).)))))))))..},.))))))))))))))).))))))))))).)))))(((((((((((((........))))..))))..))))))))))))))))....}})))}.}}........))))......,.....

Transcripts

ID Sequence Length GC content
CUCCUUCCCUGUCUCUGCCUCUCCCUCCCUUCCUCAGGCAUCAGAGCGG… 1626 nt 0.5947
Summary

The protein encoded by this gene functions in part as an adhesive glycoprotein. Differential expression of this protein can promote either cell adhesion or migration as it links cells to the extracellular matrix through a variety of ligands. These ligands include integrins, plasminogen activator inhibitor-1, and urokinase plasminogen activator receptor. This secreted protein can be present in the plasma as a monomer or dimer and forms a multimer in the extracellular matrix of several tissues. This protein also inhibits the membrane-damaging effect of the terminal cytolytic complement pathway and binds to several serpin serine protease inhibitors. This protein can also promote extracellular matrix degradation and thus plays a role in tumorigenesis. It is involved in a variety of other biological processes such as the regulation of the coagulation pathway, wound healing, and tissue remodeling. The heparin-binding domain of this protein give it anti-microbial properties. It is also a lipid binding protein that forms a principal component of high density lipoprotein. [provided by RefSeq, Aug 2020]

Forensic Context

A study in mice demonstrated that perinatal lead (Pb) exposure altered adult hippocampal gene expression, where the VTN was identified as a cell cluster marker for pericytes [Bakulski et al. DOI:10.1093/toxsci/kfaa069]. In human forensic research, the VTN mRNA was validated as a specific marker for liver tissue identification within a multiplex assay designed to infer organ origin from crime scene samples, showing high specificity and sensitivity in profiling degraded specimens [Lindenbergh et al. DOI:10.1007/s00414-013-0895-7].