Basic Information

Symbol
C1QL2
RNA class
mRNA
Alias
Complement C1q Like 2 CTRP10 C1QTNF10 C1q And Tumor Necrosis Factor-Related Protein 10 Complement Component 1, Q Subcomponent-Like 2 Complement C1q-Like Protein 2 C1q/TNF-Related Protein 10 C1q And Tumor Necrosis Factor Related Protein 10 C1q-Domain Containing Protein
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_182528.4
Sequence length
1905.0 nt
GC content
0.6824

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-915.10 kcal/mol
Thermodynamic ensemble
Free energy: -950.02 kcal/mol
Frequency: 0.0000
Diversity: 431.45
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....(((.(((((((((.((((....((((((((((....((.((.((......)).)).))((.((.((((((((((....(((((((((((.(((((((((((((((((..((.(((..((((((.(........).))))))((((((..........))))))))).))..)))))).)).....))).)).)))).))).))))))))))))))).))))).)))))))))))))))).)))))((((((((((((((((...((((...)))).)))).))))))(((((((((((((.(.((((((((.(((.(.(((((...((((((((.(((.((((((.(((((((((((((((((((((((((...............)))))))........(((((((.(.((((((..(((.((((((((((((((((((((((...((((((((.((((.(((.........)))))))))).)))))....)).))))..)))))))))))))))).))).(((....)))((((((((...((((..(((((((.((((((((.....((((.(((((.((.((((.((((((((.(((...)))))))))))...(((...)))....((.((..((.((((((.((((.(.....).)))).(((.((((((....(((.((((((((......)))))(((...(((..(((((.....)))))...))).)))...((((((.(((((((....(((((....)))))..))))))).))))))))))))...)))).)).)))(((((((((....)).)))))))......))))))))..)))).)))).)).))))).)))))))))))))))..(((((((((.((((((((((.((..(((((((((((((...))))...((((((((.((.((.....((((((...(((((...........)))))))))))..)).)))))))))).......)).))))))))).)))))).))))(((.((.(((......))))))))...(((((.......)))))..........))))))))).)))))))))))))))))))))).))))))))..))))))).....((((........))))(((((((((.(.((....)).).)).(((((.((((...(((.(((((((........)))))))..(((((((.(.(((...)))).))))))).)))...)))).)))))(((((((((..((((((................)).).)))..)))))))))......)))))))..(((((((((((((((.(((((.((((((((...)))))))).)))))))))((((.(.(((..(((....)))))).).))))...........((((.............)))).........)))))))))))....))))))))))).))....(((.(((...))).)))...)))).)))))).))))).)))))...((((..((((.....))))....)))).).))).)))))))).).)))))).(((...........)))....((.(((((((((((((((.(((((((.((((.((.((...((((......)).)))))).)).)).))))))).)))))))((.(((((((.(.(((..(((((((....)))))))..))).)))))))).)).....(((((.((.....))))))))))))))))).............))).)))).(((((.............))))))))))).................(((...)))......)))).)))........................
Thermodynamic Ensemble Prediction
.,{{.(((,(((((((((.{((|,|.|||((((((((.((.((.((.((......)).)).)}{{.(,(((((((((((....(((((((((((.(((((((((({{((({(,,((.(((.,((((((.(........,.))))))((((((.,.....,.,))))))))).}},,)))))),))....,))).)).)))).))).))))))))))))))).)))))})}}))))))))))))).))))}((((({((((((((((,..((({...}))).)))).))))))((((((((({{{...,((((((((((((((.(((((.((....(((.((((((....)))))).))|(((((((((((((((((...............)))))))........(((((((.(.((((((..(((.(((((((((((((((((((({(...(((((((,{((((.(((.........)))))))))).))))).}..}}.))))..)))))))))))))))).))).(((....)))((((((({...((((..(((((((.((((((((.....((((.(((((.,,.,,(({((((((((.(((...)))))))))))...|}}((((({....((...((((.(((((((((((,,.(((...|.,},|.|},{{{{{..,{(({((({(((({......})))}(((...(((..(((((.....)))))...))).)))|{{,(((((((((((((....(((((....))))).,))))))))))))))))))}).,,))}),))))))))))}.,)))))))).}))))))...,{{|{,(||||...))).,)),}))}))))).)))))))))))))))..(((((((((.((((((((((.{(..(((((((((((((...)))),,,((((((({,((.((.....((((((..,({(((,{,....}},,))))}))))))..)).))))))))))........,.))))))))}.)))))).)))).||.{{.(((......)))}||||..,({(((,......})))),...,,,...})))))))).)))))))))))))))))))))),})))))))..)))))))).)).{{{,.....})})).))))).)))).)))))..,|{{{((((((((,..(((.{(((((.{(((....))}...})))))).))).....((((.(((((,..(((((((.((((((.{.(((((((,{((((((((..(((({(............,...||.|,}}},,))))))))}|{||,.{{|,,...,|||(((({..(((((.(((((.((((((((...)))))))).))))))))))..})))}|))))}|}||....)))).))).}.)))))))))))))........,,,.,,|},.....,,..,))))).)))).(((((((,,{.({(,(,,.((((((((((((.(.,({.((.(.((((((((({.(((({{.,(((((.,.{({.,,,,}}...,)))))..)))).)).,,)))))}})))).)).))).)))))...)))...))))...}.,,))},.)))))))((((((((((((.((((({.....((((((((((.(.(((......,..({{{{|,.,)))))))))).)))))).))))..}}))))).))))))}}))))))))))))}....,)}),)))}}......||,|{|{.,....}})}.},.,,}........,..}}}.)})).{{{{|,},,,.....|..,,,}}}}}))}..............,,.|||,..}})..,,.,)))).}}}.,......,,|,............

Transcripts

ID Sequence Length GC content
AGAGCGCGCCGCGGAGCCGGGGCGCCCUCACUGCGCUAGGAGCCCCACU… 1905 nt 0.6824
Summary

Predicted to enable identical protein binding activity. Predicted to be involved in neurotransmitter receptor localization to postsynaptic specialization membrane; postsynaptic density assembly; and regulation of synapse maturation. Predicted to be located in extracellular region. Predicted to be part of collagen trimer. Predicted to be active in cerebellar climbing fiber to Purkinje cell synapse; hippocampal mossy fiber to CA3 synapse; and synaptic cleft. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in Wistar-albino rats demonstrated that the C1QL2 gene was highly expressed within the first 12 hours following a mild traumatic brain injury (MTBI) before being dramatically down-regulated, suggesting a role in synaptic organisation or disorganisation in damaged brain regions [Colak et al. DOI:10.1016/j.injury.2012.01.021].