Basic Information

Symbol
C4BPA
RNA class
mRNA
Alias
Complement Component 4 Binding Protein Alpha C4BP C4b-Binding Protein Alpha Chain Proline-Rich Protein PRP Complement Component 4-Binding Protein, Alpha C4bp
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_000715.4
Sequence length
2272.0 nt
GC content
0.4349

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-654.50 kcal/mol
Thermodynamic ensemble
Free energy: -702.04 kcal/mol
Frequency: 0.0000
Diversity: 530.97
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((((((.((((((......))))))....)))))))).((((((((((((((..((.(((((....((((((((((((((.....(((((((((((((((...(((((((((..((..(((((((.....((((.(((((...((((...)))))).))).))))....)))).)))..)).....((((.(((......(((((..((((((((.((.((...(((((...........))))).(((....)))....(((...(.(((((((((.......))))))))).)....)))..((((....((..........))....)))))))).)))))))).))))))))))))....))))))))).......(((.(((.((((((((((........(((((((.(((((((......)))....((((......(((((.........(((.....)))....)))))...(((((..((((((.((......))...))))).)..)))))(((((...))))).((((((((.......))))))))...))))...))))))))))))))).))))))))).)))...((((((.....)))))).......((.(((((((.........(((((((((...((((((..((.((.....)).))..)).))))...)))))))))))))))).)).))))))).(((...))).(((((.((((.(((((((.((((((((((((.....(((..(((((((((((((((((((.......((.....)))))))).)))))....)))))).)).......(((((.(((((((...(((((((((.(((........))))))).....((((((((((((((((((.....(((..(((((((((....((.(((.(....).))).))))))))).)))))..)))))))))))........)))))))........((((((....))))))..((((((....((((((((((((((((.((((((((.....))))))...(((.((((((...(((.......)))...))).))).)))...(((((((((........((((((((..(((((.((((((((((......))))))).........))).))))).)))))..)))(((.(((.........))).))).....((((.((.............)))))))))))))))....(.(((((....))))).).((((((((((((((((((((.((.(.(((((.(((((((.................((((....)))).....(((((.......)))))..((((((((.((((.....(((((((((((....))))))))))).....)))))))).)))).....((((.(((((......))))).)))).(((.((..(((......))))).)))....((((((((......)))))))).)).))))).)))))...(((..(((((((...((((((....))))))......)))))))..)))...).)))))))))((((((((((((..(((....(((...(((((((((..((.(((((....((..(((...(((...((((.((.....)))))).))).)))..))..))))))))))))))))....)))...)))..))))).....(((((........)))))))))))).))))))))..))))).............))))))))))))))))))))))))...)))))))))))).)))))((((((((.......(.((((((........)))))).).....(((.....)))))))))))...)))...)))))..........))))))).......(((((((((.............(((......))))))))))))(((((((((((((...)))))............((((((((........))))))))..)))))))).)))))))..))))))))).....))))))))........(((.(((((((...))))))))))....)))))))))..((((.......))))......((((((.....)))))).(((((.........)))))...)))))..)))))...))..)))))).....))).))))).(((.((.(((((......))))).)).)))...........
Thermodynamic Ensemble Prediction
....((((((((.((((((......))))))....))))))))....(((.((((..{,{.(((((((((((((((((.,......,.))))))|,,(((({.(({...,((((((((..(({{(((({((,,,,{{{{{.{||||,..{{{{...}}}}}}.}}}.}))},...||}|||||,,|,.....,,,,,|{,......{|{{|||((((((((({{.{{...(((((...........))))).(((....)))...,|{{...|.(((((((((.......))))))))),|,...}},.,({{{.,..,,,,........)},,}}))))},,}}.,})}|))|}))))},}})))}...))))))))))).))).(((.(((.((((((((((........(((((({{(((({{{......|}}....((((......(((((..,,.....(((.....)))....))))).,((((((..((((((.((......))...))))).)..))))))|{({...})}},.((((((((.......))))))))...))))...))))))))))))))),})))))))).})).,}}}{{(((((,,((((((((({.,,(,.,..,{{{|||,{{{({,,..}}))).,,,|||||......},},,,.}))))}.,))))))))))}}}))))))))))}}}....)))).))}.....((,(((((.((((.(((((((,((((({{.,,,,.}},.{||..(((((((((((((((((((...,...,.....}).)))))).)))))....)))))).)).,,....(((((.(((((((...((((((({(((({.......,)))))))..{{{(((((({(((((((((((...,{(((,...(((((((....({.(((.{....).))).)}))))))).))))...)))))))||||,.......,})))}......,,,|{||{|,,,,))}}}}..(((((,...,((((((((((((((((,({((((((.....))))))...(((.((((((...(((.......)))...)))},)).))).,.(((((((((........((((((((..(((((.((((((((((......))))))).........))).))))).)))))..)))({(,(((,...,,,,.}}}.}}}....,(({{.{{..,,.......,.}})))}))))))))),...{.(((((....))))).}.(((((((((((((,(({{{{,.({({{((({.(((((((.,{{{...........||||(,...,}},.{{{{(((((...,,...||}}|..,||,|||}|||,.....(((((((((((....)))))))))))...,{|||||,,,.))))}},,.((((.(((((......))))).)))).(((.({,.,{{......}}})).)))....((((((((......)))))))).}}.))))).)))},.,.(((..(((((((.,.{(((((,...})))))......)))))))..)))..,||||||||,||(((({{{(((({|,,,{,.,}|||...{{((((((,,,((.{{{{{|||,.{..{,{.,.,.....{(({.{|,,,..}}}}}},|||,,},.|))|.|}})),})))}}}}}|.|.|)))...))}.})))),.....|||||}.},,...}))))))))))).))))))))..)))))...,{{{...}}}))))))))))))))))))))))))...)))))))))))).)))))((((((((.,.....|,((((((.,....,.)))))),|,.....,,..,},.}.))))))))...{{{{.{|,,||....}}..}}))))})}.......(((((((((.............(((......))))))))))))(((((((((((({...}))))............((((((((........))))))))..)))))))).)))))))..))))))))))}{{{{{....,.((((((((((.,(((((({...}))))))|,{....,{,........{{{{.......))),)))))))))),|,,.(((((((({({,,({{{.......,,))}}.,}}|((((({,....|,....)),.....})))})))))))),,||{{((,.......))))}}},.}}},,.........

Transcripts

ID Sequence Length GC content
AACCGUCCUUGACCAGCCAACCACAUGGCUGAAAUUCAGGGACUCUUUG… 2272 nt 0.4349
Summary

This gene encodes a member of a superfamily of proteins composed predominantly of tandemly arrayed short consensus repeats of approximately 60 amino acids. Along with a single, unique beta-chain, seven identical alpha-chains encoded by this gene assemble into the predominant isoform of C4b-binding protein, a multimeric protein that controls activation of the complement cascade through the classical pathway. The genes encoding both alpha and beta chains are located adjacent to each other on human chromosome 1 in the regulator of complement activation gene cluster. Two pseudogenes of this gene are also found in the cluster. [provided by RefSeq, Jul 2008]

Forensic Context

A study in rats demonstrated that the C4BPA was significantly altered in expression on day 1 after a 20% total body surface area burn injury in liver tissue, where it was classified as an inflammation gene involved in the complement system [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025]. In human sepsis patients, RNA-sequencing of peripheral whole blood identified the C4BPA as a downregulated mRNA compared to healthy controls [Qin et al. DOI:10.1097/JCMA.0000000000000209].