| ID | Sequence | Length | GC content |
|---|---|---|---|
| AACCGUCCUUGACCAGCCAACCACAUGGCUGAAAUUCAGGGACUCUUUG… | 2272 nt | 0.4349 |
This gene encodes a member of a superfamily of proteins composed predominantly of tandemly arrayed short consensus repeats of approximately 60 amino acids. Along with a single, unique beta-chain, seven identical alpha-chains encoded by this gene assemble into the predominant isoform of C4b-binding protein, a multimeric protein that controls activation of the complement cascade through the classical pathway. The genes encoding both alpha and beta chains are located adjacent to each other on human chromosome 1 in the regulator of complement activation gene cluster. Two pseudogenes of this gene are also found in the cluster. [provided by RefSeq, Jul 2008]
A study in rats demonstrated that the C4BPA was significantly altered in expression on day 1 after a 20% total body surface area burn injury in liver tissue, where it was classified as an inflammation gene involved in the complement system [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025]. In human sepsis patients, RNA-sequencing of peripheral whole blood identified the C4BPA as a downregulated mRNA compared to healthy controls [Qin et al. DOI:10.1097/JCMA.0000000000000209].