Basic Information

Symbol
CA11
RNA class
mRNA
Alias
Carbonic Anhydrase 11 Carbonic Anhydrase-Related Protein 2 CARPX1 CARP2 Carbonic Anhydrase-Related Protein XI Carbonic Anhydrase-Related Protein 11 Carbonic Anhydrase XI CA-RP XI CA-RP II CARP-2 CA-XI CARP XI CA-RP
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_001217.5
Sequence length
1715.0 nt
GC content
0.5907

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-691.60 kcal/mol
Thermodynamic ensemble
Free energy: -721.00 kcal/mol
Frequency: 0.0000
Diversity: 354.46
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......(((((.((.(((.....(((((((((((.((((..(((((((..((((((.((((((((..(((((..((...(((((((((((((((((.((((((((((((....(((((......(((((((((((..(((...(((((((((((...((((((((((((((((..(((((....)))))(((((....)))))..............(((.(((((((((((((((........(((((((...((((.(((.(((((((((((((((...((((.......((.(((...(((((.(((((....))))).......((((.(.......((((..(....((((...((.....((((..(((((((((..(..(((((((((((((((((((.(((....))).)))))).)))))))(((((....)))))...((.....)).((((((((((.(((((...))))).((((((((((((..(((((..((((.(.(..(((..((.((((.((((((.((((.(((((((((((.......)))))).((.((((....)))))).((((.((.((((........((((....((((((((((((((((((((.((((((..(((.......))).)))))(.(((.(((.(((....(((((.(.....(((..((((((.((.((.....))))))))))))).....).)))))))).)))))).)((((...........)))).).))))).)))))).((((((.((.....)).)))))))))))))))....)))))))).)).)))).......))))))))).)))))).)))).)).)))..).).)))).))))).((.((((...((((...))))...))))..))..)))))))))))).......(((...(((....))))))(((.(((((.(((((.((......)).))))).))))).)))........))))))))))))))))....)..))))))))).))))..)).....))))....)..))))..).)))))))))..)))))......))))....)))))))))).)))))....))).))))))))))))))))).........)))))))))..))).....))))).).))))))))))............))).))))))))....)))...))...))))))))))))))...))))))...)))))).)))......(((.....)))..)))))))).....((.....)).(((((.((......)))))))))))))...)).))))))))).).))).))))))....)))))...))....)))))).)))....))))))...(((((..(((.....(((((.(((((..(((((((((((...)))).)..))))))..)))))....)))))...))).)))))((.((((.((.....((((((((......)))).)))).....)).)))).))...((((((((((..(((((.((....))..)))))..((((.......))))))))))))))..((((................))))....(((((((..((((((((((.(((((((....))))).)).))))))))))...)))))))......))).)))))))......
Thermodynamic Ensemble Prediction
....,.((((({{(.(((.....((((((,((((.{((({,(((((((.{((((((.(((,((((..(((((..((...(((((({(((((((,((.(((({,{,,{(({,{(({{{,.....,({{((((((({..(((,...(((((({(((((,((((((((((((((((..(((((....)))))(((((....)))))..............{{{.{{{(((({((((((({,......,((((((...((((.(((.(((((((((((((((,..((((..,.,..((.(((.,.(((((.(((((....))))).......((((.,.......((((..{.,.,(({{.{.({.....((((..(((((((((.,,..(((((,(((((((((((((.(((....))).)))))),,))))))(((((....)))))...{{.....}},((((((((((.(((((...))))).((((((((((((..(((((..((((.(.(..(((..((.((((.((((((.{(((.(((((((((((.......)))))).((.((((....)))))),((((.((.((((,.....,{((((....((((((((((((((((((((.,(((((..(((.......))).))))){.(((.(({.(((....(((((.(.....{((..(((((({((,({.....))))))))))))}.....).)))))))).)))))).|{(((..,|......,)))).}.)))))}}))))).((((((.((.....)).)))))})))))))))....)))))))).)).)))).,.....))))))))}.)))))).)))).)).)))..).).)))).))))).((.((((...((((...))))...))))..))..)))))))))))).((({{.(,{...,,|.,..}}),))|||.(((((.(((((.((......)).))))).))))).,,}........))))))))))))))))....,..))))))))).))))..)).,...))))..,,...))))..).))))))))).,)))}),..}..)))).},.)))))))))).))))),...))).)))))))))))))))))}.}}},.,,|||}}}}}}..}}),,,}.))))).),))))))))))............,}}.}})))))}....}}}...}),,,)))))))}))))))...)))))),,)))),}).))).,,...{||,,,,,,}),})))})))),,.,.,,.....}}.(((((.((......)))))))))))))...)).))))))))).,.))).))))))....)))))...))....)))))).)))}...))))))...(((((.{((((....(((((.(((((..((((({(((((...)))).}..))))))..)))))....}|||},,,||..,,)),}|)))|},}}}|||.((((((((......)))).)))){{{({,,.|||{.{|{,.((((((((((..(((((.((....))..)))))..((((.......))))))))))))))..{{{,.......,,,.,}},.,)))}}..{{{{{{|.,|||{{{{||{.|((((((....})))).)},)))))}}}))...))))}}}......))).))))))),.....

Transcripts

ID Sequence Length GC content
AAGAGAGAAGAGAGACUGAAACAGGGAGAAGAGGCAGGAGAGGAGGAGG… 1715 nt 0.5907
Summary

Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA XI is likely a secreted protein, however, radical changes at active site residues completely conserved in CA isozymes with catalytic activity, make it unlikely that it has carbonic anhydrase activity. It shares properties in common with two other acatalytic CA isoforms, CA VIII and CA X. CA XI is most abundantly expressed in brain, and may play a general role in the central nervous system. [provided by RefSeq, Jul 2008]

Forensic Context

No relevant information is available at the moment.