Basic Information

Symbol
ACTA2
RNA class
mRNA
Alias
Actin Alpha 2, Smooth Muscle ACTSA Cell Growth-Inhibiting Gene 46 Protein Actin, Alpha 2, Smooth Muscle, Aorta Actin, Aortic Smooth Muscle Alpha-Cardiac Actin Alpha-Actin-2 EC 3.6.4.- SMDYS ACTVS
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_001613.4
Sequence length
1349.0 nt
GC content
0.5182

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-418.70 kcal/mol
Thermodynamic ensemble
Free energy: -442.93 kcal/mol
Frequency: 0.0000
Diversity: 428.00
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((..((((((...((......))...)))))).((((((...(((((((((...((((...((((((.((((((((((((((((((((.((((.((.(((((((((...((((......))))((((((((.((((......(.((((.((((((((((((((.....)))))).((((((..(((((........)))))....))))))....)))))))..).)))).)(((((((.((.....((((((....((.((((.((..((.((((.......(((....))).......))))))..)).))......)).)).....))))))......)).)))))))..((((.(((..(((((........))))).))).)))))))).).....)))))))....((((.(...((((((((((...)))))))....))).).))))))))))...))).)))))).))))))))))))).)))).....)))...)))))).))))....(((.(((((..(((((((((.((((((..(((((((...(((((((.((((........)))))))....(((((.((((((.(((((..(((((.((((((.(((((...((((((..........((.(((((((..((......))..)))).))).))))))))...))).(((((((((.((((...((((((((.((((((((.......((..(((((.((((....))))....)))))..))........)))))))).(.((((((...)))))).).((((((..(((((((....))))))).((((.((((((.(((...)))(((((((.....))))))).)))).))))))..(((((.................)))))..).)))))..))))).))).......)))).))......)))))))..(((((.(((......))).)))))(((((........)))))...)))))))).))))))))).).)))).)))))))))))...)).)))))....((((((..(........)..))))))..)))))).)))))(((((.((..(((...(((....((.(((....))).))....)))...)))..)).)))))....))))..))))).)))...))))))....)))..)))))).........(((...(((......(((.(((((.....(((((....((.....))....)))))...))))).))).....)))..)))..((..(((((..((((......)))).....)))))..))))))..
Thermodynamic Ensemble Prediction
....,,,,.,((({(,(((((({.,{{({..,||.|||,((((...}}|}.{,{||{|.,{{((,,.(((((,.{({(((((((((((((((({,((,..{{.{{{{(((({...((((......)))){((({{{||(((,....,,||||{{,((((((((((((((.....))))),.((((((..(((((........)))))....))))))....)))))))).|,||||{|(((((((.((..{..{(((((,...((.{{{(,((..((.((({.......,((,...}}}..,,...})))))..)).))....,.)}.))...,.)))))}......)).))))))),.||||.({(..({(((,....,..}))}}.|||.}}}|||||||..,},))}))))....((((.(...,({(((((((...)))))))...,)},.}.))))|||||}...})),))},.))))))))))))))).))))..,,.}}},.,}})}}}.}}))},,.(((,(((((.,(((((((((.(,((,{..,,,||,|.,,|||{(((.((((........)))))))}...(((((.((((((.,((((..(((((.((((((.(((((...((((((..........((.(((((((.,({......}}..)))).))).))))))))...}}}.{{(((({{,.(|{,...||,||||.,((((((((...,...({..((((({((((....)))}.,},}))))..))....,,,.)))))))),,.{{,((({{{{,,|||,|.{((({{..(((((((....))))))).{({{{((((((.(((,,,|},{{{{{{{.....))))))).)))).)))))}..(((((..............,..)))))..}.))))),})}.))))))).||||{}},,.}}......}})))))..(((((.(((......))).)))))(((((........)))))...}})))))).))))))))).,.)))).))))))).|||...||,},|||{{,,,,{||{}.|,,....,|}||}}}}}}..}}}|||.}||||{{{{{.{,.,{({|||{|,||,.||.}},}}}}),)}),...,}||,..,.},,||||}}||},..}}}}..))))}.))}...}))))).........,,,)))}}}}.,.,,|{{,,.|||,,....{{|,|{(((.....{((({....|{.....)}....)))))...))))),))).....)))..)}},,||,,(({{{,,{,,{,,....,}}......)))))..)))))}..

Transcripts

ID Sequence Length GC content
GAACACCACCCAGUGUGGAGCAGCCCAGCCAAGCACUGUCAGGAAUCCU… 1349 nt 0.5182
Showing 11 to 11 of 11 entries
Summary

This gene encodes one of six different actin proteins. Actins are highly conserved proteins that are involved in cell motility, structure, integrity, and intercellular signaling. The encoded protein is a smooth muscle actin that is involved in vascular contractility and blood pressure homeostasis. Mutations in this gene cause a variety of vascular diseases, such as thoracic aortic disease, coronary artery disease, stroke, and Moyamoya disease, as well as multisystemic smooth muscle dysfunction syndrome. [provided by RefSeq, Sep 2017]

Forensic Context

A study in humans using single-cell RNA sequencing of corpus cavernosum tissue from patients with severe erectile dysfunction identified ACTA2 as a smooth muscle cell marker used for cell type annotation [Fang et al. DOI:10.3389/fendo.2022.874915]. Another human study profiling cavernosal single-cell transcriptomes from normal and organic erectile dysfunction patients confirmed ACTA2 as a gene and protein marker highly expressed in the smooth muscle cell cluster [Zhao et al. DOI:10.1038/s41467-022-31950-9].