| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAACACCACCCAGUGUGGAGCAGCCCAGCCAAGCACUGUCAGGAAUCCU… | 1349 nt | 0.5182 |
This gene encodes one of six different actin proteins. Actins are highly conserved proteins that are involved in cell motility, structure, integrity, and intercellular signaling. The encoded protein is a smooth muscle actin that is involved in vascular contractility and blood pressure homeostasis. Mutations in this gene cause a variety of vascular diseases, such as thoracic aortic disease, coronary artery disease, stroke, and Moyamoya disease, as well as multisystemic smooth muscle dysfunction syndrome. [provided by RefSeq, Sep 2017]
A study in humans using single-cell RNA sequencing of corpus cavernosum tissue from patients with severe erectile dysfunction identified ACTA2 as a smooth muscle cell marker used for cell type annotation [Fang et al. DOI:10.3389/fendo.2022.874915]. Another human study profiling cavernosal single-cell transcriptomes from normal and organic erectile dysfunction patients confirmed ACTA2 as a gene and protein marker highly expressed in the smooth muscle cell cluster [Zhao et al. DOI:10.1038/s41467-022-31950-9].