Basic Information

Symbol
CCDC88C
RNA class
mRNA
Alias
Coiled-Coil And HOOK Domain Protein 88C KIAA1509 DAPLE HkRP2 Dvl-Associating Protein With A High Frequency Of Leucine Residues Coiled-Coil Domain Containing 88C SCA40 Spinocerebellar Ataxia 40 Hook-Related Protein 2 Protein Daple Coiled-Coil Domain-Containing Protein 88C HDaple HYC1
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_001080414.4
Sequence length
7519.0 nt
GC content
0.5884

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3025.50 kcal/mol
Thermodynamic ensemble
Free energy: -3147.24 kcal/mol
Frequency: 0.0000
Diversity: 1799.37
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((((((((((((.((((((((((..((.((((((((.((((.(.(((((...((((((..(.((((...)))).)))))))...)))))))))).)))))))).))))))))((((((((.((((((...((((((((((..((...((((((.(((((......)))))(((((...(((..((((.(((...))).)))))))....)))))...))))))...)).)))..))).))))....((((((.((((((((((((((.((...(((((((.........(((((((((((...(((((.((((..........(((((...((((((((....))))).)))....)))))..((((((((.....))))))))(((......)))((((((....(((......)))...)))))).....)))).)))))...)))............))))))))..))))))).))...))))))))))))))))))))))))))))))))))((((((((((..((........((.....)).......))..))).)))))))((((......((((((....((((.((.......)).(((........)))........(((((((.((((((((((((((((((((.....)))))))))).(((((.....(((((....))).)).....))))).((((.(((((.(((.(((.((((((..(....)..))..)))).)))))).)))).).)))).......))).))))))))).)))))))))))))))...)))).((((((((((((...(((((...((((.(((.(..((((((((((((((...((((((.((..((((((((((..((((((........)))))).))))))).(.((.(((....))).)).)......))).)).))))))...((((........))))..(((((....)))))((((......))))..(((((.((..((((((((...(((((((.....)))))))(((..(....)..))))))))))))))))))..............))).)))))))))))..).))).))))...((.((((.(......)))))))..)))))(((((.(..(((((.......)).)))..))))))......(((.......)))......)))...))))))))).((((.....)))))))).)))))))).)))))))(((((.(((((.(...((....))).)))))....((((((((((.((((((((.......)))))..................))).))))))..))))..........(((((((((...(((((..(((.((((((((((((.....((((.......))))..(((((((..(((..((((........)))).)))..).))))))....))))))))))))..))).......)))))..((((.(((.((((((((.((((((((((((((((...((((((..((((((....(((((.(((...))))))))))))))))))))........(((.(((..((((((((((....((....)).)))))))..(((.....)))............))).))).)))((.((((((((..(((((........((((((.....((.((((((((((((((((.(.((((((((...(((((((((((((..((((.((((((.....)))).((((((((.((((((((..((((......(((((((((....)))....)))))).))))....))))))((.((((........)))).)).........((((((((((((..((..(.((((((((....)))...))))).)..))((((((((((((((((((((.(((....((((..(((((...(((.(((((....((((..((.((.(((((((.((((......(((...((.((((((.(((.((((((.((((.....(((..(((((.(((((.(((...))).)))))...))))).))).........(((((((((..(....)..)))))))))....((((....)))).))))..)).)))).)))(((((.(((((((..((((...((((((((.(((..((...((((..((.(.....).)).))))..))..))).))))))))...((((((((((........)))))))))).....(((((.(((..(((((..(.(((((.((((((.((((((((.(((((.(((((((.((....((.((((((((((....((((((((.....(((((((((((((((.((((((((.((((..(((.(((((((.....((((((((.......)))).)))).....))))..((((........))))........)))..)))..)))).)))))))).)))))))))((((.(((.((....))(((((((((((((....)).)))))))))))((((.....((.((((..((.(((((....((((((((((((((((......))......((((((((.(..(((((((.((((((.(.(((((..(((((.((((((((......)))))......))).)))))...))))))))))))(((.(((...(((((((.((((...(((((((.(((.(((((......))))).))).))))......(((((.((.(..(.....)..).)).)).)))..((((..((.(......).))..))))...(((((((((((....((((((((....(((....)))((((((((((....))))))......))))..((((...))))....((.(((((.......(..((((((((((..(.....)..))))))))))..).((((((.....))))))((((((...((((......)))).........(((.((((((..............((((((......)))))).............((((.......))))..(((((((.((((((((....((((......(((((((....(((((...............)))))(((.....)))...((((((((((((.(((....)))......(((((......((((((...((.(((((((((((((((((((..(((((((......).)))..)))..))...)).))))))).....(((((.(((........(((((.....)))))....(((((((.........))))))).....((((....))))...(((..(((((((..((((((.((((...(((((.....(..((...((((((((.((.......((((.((((((...............))))))))))....((((.(((((.((((...)))).)))))......(((((((....))))).)).......((....))....)))).((.....))....(((((.......))))).((........))(((((...))))))).))))))))...))..)...((((((.((((..(..((((.....((((........)))).....))))..)..))))))))))......))))))))).)))))).))))))))))..((((....(((((.(((..((((....(((((((.(((((..((((((((((((((((..((.(((((((.(((.((.(((((.((((((((.......))))........)))))))))))))).)))).))).((((((((..((((((.(((.(((((......))))).....(((((((.((((((.((..((((((.(((.((.......((..(((........)))..)).....)).)))((((..(((((((.(((((..(((.(((((((......)))))(((((((.((((....(((...(((.(((.....))).)))...)))))).).)))))))((((........))))....(((((..((......)).))))))).)))....))))).)))))))))))....((((.((((((((........(((((...((........)).))))).....))))))))....................(((((........))))).....))))........((((((((.(.......).)))))))).)))))).............((((((((((.((((.....(((...((.(((((.((............))))))).)))))...))))..))))))..))))...)).))))))..))))))).(((....))).))).)))))).))))))))))..))))))(((((.((((((.....((((.(((..((((...(((((((.....((((......)))))).)))))...))))..)))))))...)).))))..)))))..........(((((((.((........)).)))))))...(((....))))))).((((...(((((........))))).)))).....))))))....)))))....)))))))...))))...))).)))))..))))........)))))))).))))))))...))...((((....(.((((........)))).)))))..)))))).(((((.(((.....))).)))))..........)))))......)))).))))).)))....)))).))))))).))))))))))).)))).......((((....)))).....)))))).)))((((.....))))..((((((.((.(.((((.....)))).).))...))))))(((((............))))).......))))))))))))).)))))))))))).)))))))..((((((((((....)))))).))))....(((((((...))))))))))...)))).)))))))))).))))))))))))))))))).....(((((.(((((.(((((((.(((.((.((((.......)))).))...))).)).)))))......))))).))))).)))).).).))))))))....((((..((((.........))))..))))..))))).)).)))))).(.((((...((((......)))).....)))).)))))))).))))......((((.(((((......).)))).)))).((((((....(((..........)))...)))))).))))))(.(((....))).).)))))))).((((.(((((((((.(..........).))))))))).)))).......)))))).))))))...)))))))))))..((((.(((.....)))))))((((((..(((((((.....)))))))((((...((((((((((.((((.((((((..(((((((.....(((((((((((.........))))))))))))))))))...(((((((((((.((((.(((((((.((((....((((((.........(((((..(((((..((((.(((.((...)).))).))))..)))))(((((...))))).((((...(((((..((((((((..((((.(((((((((((((((((.(((.....)))..))))))).(((((((....(((...)))...)))..))))..)))).)))....((((((.((((((((((((((((....)))))))))))....))))).)))))).........)).).)))).))))))))..)))))..)))).((((((((((.((..((((((.(((((...))))).))))))..))))..))))...))))......))))).((((.(((.(((((.(((((((..(((((.((((((((((..(((((.(((((((....))))))))))))........)))))))((((.((.........)).))))))).)))))....))))))).)))))...))).))))))))))....))))...)))))))..((((.(((..(.((((....(((..((((((.................)))))).))))))))..))))))).....)))))))))).))))))))))).).))).)))))))))).....))))..))))))))).)))))..))).)))))).))))).)....((((((((.((..((.(((....((((......))))..))).))..)))))))))).((((((((.(((...))).((((((.....((((........)))).)))))).(((((.....((((..((......))..))))....)))))..))))))))..)))))...))).)))))...))))...))))))).))))).)))))).)).)))....................(((((.(.((((....)))).).))))).....)))).)))))))))))..))))...((((((((((((((...(((.((((.(((.((....))))).))))((((((((..........)))))))).(((.(((.....))).))).)))...)))...)))))))))))..................))))).)))...))))))))).((((((.((((.(......).)))).)))))).))).)))))))))))...)))))).))).(((((((((((((((.......((((....))))))))))).))))))))))).))))))))).....)).)))))))).(((((((.....(((((((.(((..(......)..))).)))))))))))))).(.(((((...))))))...((((...(((((....((.((((....((.....))...)))).))))))).))))((((.(((((....)))))))))..(((((.((((((......)))))).)))))..........................(((((((((..(((....)))...))))))))).)).))))..)))))......(((....))))))))))).((((....))))........)))))))).).))))))))))).))))).))......)))))).))))).....)))))))))).((((.......))))..))))))))))))......(((((((((((..................))))))))))).(..(((........)))..)....))))))))))))))).))))((((((.......)))))).(((......))))))))))))....((((......)))).)))))......
Thermodynamic Ensemble Prediction
..({(((((((((((((.((((((((((..((.((((((((.((((,{.(((((...((((((,,{.({{{.,,)))).)))))))...)))))))))).)))))))).))))))))((((((((.(((((({(((......)))}.(({((((,{{|}|||||,,{,,,}}}||{{(((..,{{{.{((((.(({...})).))))),,....)))))}.}}||||}...}}}),|,.,,,.}},)}...((((((.((((((((((((((.((...(((((((.........((((((((,,,...,{{,..((,,......||..(((((...((((((((....))))),}))....)))))..((((((((.....)))))))}.,,....,,)))|,|{{|,,,.{{{{|,,,|}}}...|},||{{{{{{{{||.,,.,,.,})))}}},........))))))))..))))))).))...)))))))))))))))))))))))))))))))))){(((((((((,.((.....,,,,,.,,..,}.......))..})||))))))},{{,......{(((((..||{(((,{{....||,||,{((..,,{.,.,,}..,,,...(((({{{.(((((((((((((({((({(,{{{{|,||||||||.,,.,|}}}}}|)).}}}}}.||{||,...}))))).((((.(((((.(((.(((.(((({(,.{....}..))..)))).)))))).)))).).))))..,{{|.}},}})))))))}.}))}}}}}}))})))...}},,.((((((((((((..{(((((,,,((((.(((,(.,({((((((((,((,....,..|{,{{.(((((((((((..((((((........)))))).))))))).,.,|,||({.{,|||{...,......}}}.,)})))),)|..((((........))))..||{{|.,.,)))))((((......))))..(((((.((,.{(((((((.,,(((((((.....))))))}|||..,....}..,)}))))))))))))))).}}}}..}})....})).)))})}))))),.).))),)))}..,{(|{((,,{......}}))),}..)))),(((((.,..(((((.......)).)))..})))))......{{,.......}},...,,.)))...))))))))}.((((.....)))))))).)))))))).)))))))((({(.(((((.{..,((....))).)))))....((((((((((.(({(((((.......)))))..................))).))))))..))))......,...(((((((((..{(((((..(((.((((((((((((..{,.((({.....}.})))..(((((((..(((..((((........)))).)))..),})))))....))))))))))))..))).......)))))},((((,{((.{((((({|,({{{((((((((((((|..((((({,.{(({{,.{{((((((.(((...)))))))))))))))))))),{{{{,,{((,...,{{((((((((((,...((....)).||||||}..,.....{{{{,...}}}}.....,}}}))))).|{(.({,,,,(({,,{.,,...,.,},|{{{{{.,,,.((.((((((((((((((((.{.((((((((.,.(((((((((((((..((((.((((((.....)))).((((((((.((((((((..((((......(((((((((....)))....)))))).))))....))))))((.((((........)))).)).........((((((((((((..,,..(,((((((((....))),..))))),,..,,((((((((((((((((((((.(((.,.,(((((,(((((.,.((({(((((,((,((((..((,(..((((({(,((((.{{...((((,{(,,{{,{{{.||||,.((((....|}}}..(((..(((((.(((((.(((...))).)))))...))))).))}......|,,(((((((((..(....)..))))))))).|.{(((({{..||||.|||,,,||,.}}},},((((((.((....}}.)))))).,(((((((.(((..((...((((..{{.,.....}.}}.))))..))..))).)))))))|..,((((((((((........)))))))))).....{|{(({(({,.{{,...,(.{{{{|,{(({((,(((({(((.{{,((.(((((((.((....((.((((((((((...{((((((((.....(((((((((((((((.((((((((.((((..(((.(((((((.....((((((((.......)))).))))..,,,)}}},.((((........))))........)))..)))..)))).)))))))).))))))))){{((,(((.(({,,.||(((((((((((((....)).))))))))}||((((..,..({.({((..((.(((((....((((((((((((((((......,,......((((((((.(..(((((((.((((((.{.(((((..(((((.((((((((......})))),.....})).)))))...)))))}))))))(((.(((...(((((((.((((,,.(((((((.(((.(((((......))))).))).))))...,,.{((((.{,.{,.{..,,,}..)))).}}.,}}..((((..((.(......).))..))))...((((((({(((....((((((((....((({...,,|||||{(((((,,..|}}}}},.....}))},,((((...))))....((.(((((.......(..((((((((((..(.....)..))))))))))..).((((((.....))))))((((((...{(((......)))}.........,,,.{{({{{.............{((((((......))))))},|{{,.,.,...((((.......))))..(((((((.((((((((....((((......(((((((,...(((((,{{,....,..{,,,|||}}{({{,..,)))...,|||||||,,{{.{{{,}.,))}...,..((((({,,.,.((((((,..((.(((((((((((((((((.,..(((((({.,...,}.)))}})}}..,}...)).))))))).....(((((.(((,.....{{((((({{{{{||{||....{||||||,....,...})))))),....((((....))))...(((..(((((((..((((((.((((...(((((.....{.,((,..((((((((.{{.......((((.((((((...............)))))))))).{{,(((,.,{{{|}||||...||||,},}))}}}...(((((((....})))),))....,,.{{....))....,,...{|,....},...{(((||..}}}}.}|}}}.||......{,|}(((((...)))))))}))))))))...,}.,)..,{(((((.((((..(..((((.....((((........)))).....))))..)..)))))))))}......))))))))).)))))).))))))))))..((((....(((((.(((..((((....(((((((.(((((.{((((((((((((((((..(,.(((((((.(((.((.(((((.((((((((.......))))........)))))))))))))).)))),,)),((((((((..((((((,(((.(((((......))))).....(((((((.{(((((.({..((((((((((.((,......,,,{(((.,......))).,)}.....}).)))|||{,.(((((((.(((((..(((.{{((({,....,,,)}}}(((((((.((((....(((...(((.(((.....))).)))...)))))).).)))))))((((........)))}....(((((..({......}}.))))).).)))....))))).)))))))||||....{{,{.((((((((...{....(((((...((........)).))))).....)))))))),,..................(((((.,....,.)))))....,)))}........((((((((.{.......}.)))))))),}))})),............((((((((((.((((.....((({..,,.{{(((.((........,,..)))}})},})))}...))))..))))))..))))...}).))))))..))))))).(((....))).))).)))))).))))))))))..))))))(((((.((((((.....((((.(((..((((...((((({{.....((((......)))))}.)))))...))))..)))))))...))))}))..)))))..........(((((((,((,.....}.)).)))))))...(({....})))))).((((...(((((.{....,.))))).)))).....)))))),}..)))))....)))))))...))))...))).)))))..)))).......,)))))))).))))))))...)}...((((....,.((((.,......)))).})))).,)))))).|||||.(({.....})).},|||{.....))}})))))......||||.,,)))},,,....}))).))))))).)))))))))))},)))......,||||.,,.}}}}..})})))|||{|||(({,,.,{|}},}..{|{{||.||.{.((((.....)))).}.)),,.}}}|||(((((............)))))..,},..))))))))))))).)))))))))))).)))))))..((((((((((....)))))).))))....(((((((...))))))))))..,)))).)))))))))).))))))))))))))))))).....(((((,(({((,(((((((.(((.((.((((.......)))).))...))).)).)))))....,.)}))).))))).)))).).).))))))))....((({..{({{......,,,})))..))))..))))).)).))))))...,..,..{((((,,.,..|}}}.....)})).)))))))}.}}})}....,((((.(((({.{....).)))).))))}((((((....(((..........)))...)))))).)))))){.(((....))).}.)))))))).((((.(((((((((.{..........).))))))))).))))....,..)))))).))))))..,)})))))))))..{|||||{|,,,,.))}))))||||||,,|||||{{,,,,,))))))|((({.{{({(((((({{,((({.(((((((.,,|||||}}...(((((((((((.........))))))))))),)))))|,||{((({{{{{{{.{{((.({{{{{{.|||{...|{{{{||.,}||||..(({({..{((((..((((.(((.((...)).))).))))..))))}(((((...))))),{{||,,,|||||,.|||||{{|,,|||(.,,,.{,((({(((((((.(((.....)))..))))))),(((((((....{{{,..))),.,||||.,|||.,||||,{{||{.,((((((.((((((((((((((((....)))))))))))....))))).)))}}},.,|||.,.}|,|,||||,|}}|||}|,.|||||..|||}.{|||((((((.((..((((((.(((((...))))).))))))..))))..))))...}|||,.....)))))..}}))}}|,||||}.||||||||||{{(({(({.{{(({{..((({({(((((((....))))))))))))......,,))))}}|||||{{,{{{{|{|,,|}{|((|||,,||}}...,,}}}}}}}{|||||||{||,.,}},}}))))..,|}}||.,,}|}}}}}..((((.(((..({((((,|.,{{,{{(,((((.........,,}},}}.,)),},.,))))))}..))))))).....}}}}}}|||||||}},,}}}}}|||}}}.})})}||}}},||..}}}},.}}|||}}}).)}}||.,|}|,}}||}}.|}}||,},...{{{{{{{|,|||||,.||||,..((((....,.)))}..))}}))},,,)))))))).((((((((.(((...))).((((((.....((((........)))).)))))).{((((,....((((..((......))..))))..,,)))}}..))))))))..}))))},.},},.}}|}|||||||...,},}},,,||}}|{||||,|,,,,|||.,..................{||||,|,{|||,,.,}}}}.}.))))).....)))).}}))))))))}..||||.||{{{.,{||||||,,{{{....,,||,,{|.||.,...))}}}))))|||||||{.,,,......)))}))))}|||.|,.....}))}}}))})}|||||||,..{{{|||||{...{{{.......})}.})})))))},}}.}}))))))))),||||||.||||,|.,,,..),))}}.}))))),))).))))))))))),..}))))).))).(((((((((((((((,......{(((....)))))))))))}}}))))))))).))))))))).....)).)))))))).(((((((,....(((((((.(((..{......)..))).)))))))))))))).{.(((({...))))),...((((...((((,...,((.((((,,..{{.....)),,.)))).))))))).))))((((.(((((....))))))))),.{(({{.{{(({{......}}}}}}.}}}}}...,,,....................(((((((({{{((,...,)))...))))))))).)).))))..)))))......(((....))))))))))),{(((....)))}........)))))))).}.))))))))))).))))).))..,,,,))))))}))},,..,}}))))))}}}}.((((.......)))).})))))))))))),,,,.,{{{{{{{((((,,,,{........,...,)}))}}}})}}}|||}}|{{{{{....,,..}}}},}))||||}}}}}}}}.}}}}((((((.......)))))).,,{....}})}.)))))))))..,,|},|......,})},}}}}}......

Transcripts

ID Sequence Length GC content
GCCUUUGUCUCCCGGGCGCGAGCCGCCGCAGCCCCGCGCCCGCUGCUCG… 7519 nt 0.5884
Summary

This gene encodes a ubiquitously expressed coiled-coil domain-containing protein that interacts with the dishevelled protein and is a negative regulator of the Wnt signalling pathway. The protein encoded by this gene has a PDZ-domain binding motif in its C-terminus with which it interacts with the dishevelled protein. Dishevelled is a scaffold protein involved in the regulation of the Wnt signaling pathway. The Wnt signaling pathway plays an important role in embryonic development, tissue maintenance, and cancer progression. Mutations in this gene cause autosomal recessive, primary non-syndromic congenital hydrocephalus; a condition characterized by excessive accumulation of cerebrospinal fluid in the ventricles of the brain. [provided by RefSeq, Jan 2013]

Forensic Context

A study in mouse cardiac mesenchymal stem cells demonstrated that overexpression of the CCDC88C led to its significant downregulation, as part of a broader transcriptional reprogramming that suppressed pathways related to nucleotide transport and phagolysosome processes while activating cell cycle progression and proliferation [Zhang et al. DOI:10.3390/biom15050662].