Basic Information

Symbol
CCN1
RNA class
mRNA
Alias
Cellular Communication Network Factor 1 GIG1 IGFBP10 CYR61 Insulin-Like Growth Factor-Binding Protein 10 Cysteine Rich Angiogenic Inducer 61 IGF-Binding Protein 10 CCN Family Member 1 Protein CYR61 IGFBP-10 IBP-10 Cysteine-Rich Heparin-Binding Protein 61 Cysteine-Rich, Anigogenic Inducer, 61 Cysteine-Rich Angiogenic Inducer 61 Protein GIG1
Location (GRCh38)
Forensic tag(s)
Forensic psychiatry evaluation Sudden death from respiratory system disease Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_001554.5
Sequence length
2278.0 nt
GC content
0.5048

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-749.00 kcal/mol
Thermodynamic ensemble
Free energy: -790.35 kcal/mol
Frequency: 0.0000
Diversity: 482.14
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....(.((((..(((((((((((.((.(.(...((((.....))))...).).))))))....((.(((.....))).))........(((((((((.(((((((((((...))))(((((((((((.((((((.(((((((((.(((((((.(((((((((((..(((((((.((((.((..((((.(((((((.((.(((((((((((((((.(((((((...((((.(((.........))).))))((((..((((...............)))).)))).(((((.(((((...((...((.....))....))....))))))))))...))).)))))))))))......)))))))).)))).))))).(((((..(((....)))..)))))......(((.((((........)))).)))))))..)).)))).)))))))..)))).((((((((.((((((((((((((((.((.....)).))))))....(((.((((....)))).))).......(((((..(((......((((((((.(....(((((((.(.((...(((((((((....)))))))))..)).))))))))).)))).))))((((....((((((((.(((((((...))))..(.((((..(((((((((.((.........)).))))....)))))..)))).)......))))))))).))..)))).(((.(((((.((.....))))))).)))...))).)))))..(((.......))))))))))))).)).....((((......)))).(((((.......)))))..)))))).((((((..((((...))))))))))(((((.(((.(((((.((((((((((((..((.(((..((((....))))...)))..))...(((((((..(...(((.(...(((((.(((.....))).))))).).))).)..))))))).))))))))))........))..)))))))))))))....)))))))))).)))).)))).((((......))))......(((((((.................(((((.....)))))..(((((((.((...)).)))))))........(((((....(((.((((...)))))))...))))).)))))))(((((........((((((((.((..(((..((((...((.(((((((......))))))))).))))..))).....)))))))))).....(((........))).(((.(((.......)))))).....((((......((((((..((((((((....((((((...))))))((..(((((....)))))))...(((.(.....).))).....))))))))))).)))......)))).....)))))))))).).((((((......)))))).((((...(((((((((((((.........)))))...)))).))))....))))...))))).)))))))).)))............((((((....((((((...(((((((......)))))))..)))).))((((((...))))))))))))((((...(((..((((.((((((((((((........(((((.(.((((.(((((.((((...((((....))))......)))).....))))).)))).).))))).((((.(..((((...))))..)))))..............((((((.....))))))(((((....)))))((((((((...))))))))((.((((((((....)))).))))..)))))))))))))).)))).)))....))))(((.(((.(((((....))))).))).)))))))))))))))...........)))).....((((((((((...(((((((((((...(((((((...)))))))))))))))))).))))).)))))...........((((...(((((((.....))))))).....)))).))))))).........((((.....)))))))).)(((((((((...((......))...)))))).)))((((((..((((...(((....)))...)))).)))))).......((((((........(((((((((((((((.((..(((((((..........)))))))..)).)))))))........)))))))))))))).....
Thermodynamic Ensemble Prediction
....,(.(((((,(((((({,,,(.({.{,{...{|||.,,,.))))..,},},||||||....((.(((.....))).))}})).,},{{{{({{((.((((((({(((...||||((({((({(((,((((({..{((,((((.((((((,{(((((((((((..(((((((.((((.((..((((.(((((((.((.((((((((((((((({(((((((...((((.(((.........))).))))((((..((((...............)))).)))).(((((.(((((...((...((.....))....))....))))))))))...)))})))))))))))......)))))))).)))},))))).(((((..(((....)))..)))))......(((.((((........)))).)))))))..)).)))).)))))))..))))..(((,,((.((((((((((((((((.{({...,)).))))))....(((.((((....)))).))).......{((((..{{{......((((((((.{....(((((({,(.((...(((((((((....)))))))))..)).))))))))}.)))),)}))((((....{{((((((.(((((({...}))),.(.((((.,(((((((((.((.........)).))))....))))).,)))).).,....))))))))).}}..)))).(((.(((((.((.....))))))).)))...))},))))}..{{{.......))})))))))))).)).}},.{{{{..,,,,,,}},||||,...{{{{|.(({....,,)))((((((.,,,,....},,.)))))).((((.(((.(((((,((((((((((((,,,...,{..,{({....}}}}.,,||,|{{{,,,({{(({,..|..,||{}|,..(((((.(((.....))).))))).,.}}}.,..))}))}}.)))))))))).,......))..)))))))))))))}}}})))))))))).)))).)))).((((,....,|||}......(((((((.................(((((.....)))))..(((((((.({...}).)))))))........(((((...,({(,((({...})))))).,,))))).))))))){(({{..||....((((((((.((..(((..((((...((.(((((((......))))))))).))))..))).....)))))))))).....||,,,,,,..,|||,(((.(((.......)))))},,,,,|||,..,|,}||({({..((((((((....{(((((...)))))}{(..(((((....)))))}}...(((.|.....}.})),....))))))))}}}.}}}.....,)},}.....))))))}})))))}.)}))).,))).}}}.,.((((...{((((((((((((.........)))))...)))).})))....))))...)))}},}))})))).})).,,|,...||,.||{,{{.,||{{,,,{,..(((((((......)))))))...}},.,.((({(|...}))))),,)))}((((...(({..((((.((((((((((((........(((((.{.((((.(((((.((((....{(({...})))......)))).....))))).)))).}.))))).((((.(..{({,...}}})..}))))..,.,,...,},..,,((((,,,..}}}}}}|||||,,..,}}}}((((((((...)))))))),{.((((((((....)))).))))..,,)))))))))))).)))).))}.,,,|||},,,.|||,||{{{...,}}})}.})).},})))})))))))}},.......,,||||{{{,,,,,,(((({,..,|||{,,||||{}},||||{{....|||||||,||||,,,,,,}))),,)})))}......,,,..,,{{,{,(((((((.....)))))))}}}..})))|)))}}|||........{({{.....)))})))).}{({((((((...((.....,))...)))))).))}{(((((.,,{,{..,{{{.....,....}}}).))))))....,..((((((,,,,,,..,{||||||(((((((.((..(((((((..........)))))))..)).)))))))........}}}})})})))))).,...

Transcripts

ID Sequence Length GC content
AGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCUCCGCGCCU… 2278 nt 0.5048
Summary

The secreted protein encoded by this gene is growth factor-inducible and promotes the adhesion of endothelial cells. The encoded protein interacts with several integrins and with heparan sulfate proteoglycan. This protein also plays a role in cell proliferation, differentiation, angiogenesis, apoptosis, and extracellular matrix formation. [provided by RefSeq, Sep 2011]

Forensic Context

A study in rats demonstrated that the CCN1 shows developmentally regulated expressional alterations in response to schizophrenomimetics after a critical postnatal period [Yamamoto et al. DOI:10.1016/J.Euroneuro.2014.07.010]. A study in mice demonstrated that hyperoxia exposure significantly upregulated the CCN1 mRNA level, suggesting a serious risk for developing fibrosing alveolitis [Shimada et al. DOI:10.1007/S00414-008-0226-6]. In human and mouse studies of heart failure post-myocardial infarction, the CCN1 was identified as a hub gene in a specific fibroblast module [Wang et al. DOI:10.1016/j.ijbiomac.2025.143171].