Basic Information

Symbol
CCN2
RNA class
mRNA
Alias
Cellular Communication Network Factor 2 IGFBP8 Connective Tissue Growth Factor CTGF Hypertrophic Chondrocyte-Specific Protein 24 Insulin-Like Growth Factor-Binding Protein 8 IGF-Binding Protein 8 CCN Family Member 2 HCS24 IBP-8 SEMDLSL IGFBP-8 NOV2 KMD
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_001901.4
Sequence length
2338.0 nt
GC content
0.5145

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-808.40 kcal/mol
Thermodynamic ensemble
Free energy: -850.63 kcal/mol
Frequency: 0.0000
Diversity: 511.14
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((.....((((((........)))))).......((((((((((((.....((((((.((((.(((((((((((((..((((..(((..(((((...((((.((...((((.........)))))))))).((((((..((...(((.(((((((((..(((((((.((((..((((((.(((((.(((((((..(((((((.((.(((......((((...))))))).))...))))))).......((((.((((((..(((((.....)))))....)))))).)))).((((((((.(......).)))))))).)))))))..)))))))).)))...)))).))).)))).))((((((((.(((....))).).)))))))))).)))).)))..))))))))..(((.((((...))))...)))......))))).))).))))...)))))..((((.......(((.(((((((((((..((.(((((.....))))).))..)))..))))))))))).))))........(((((.(((..((((........))))..)))))))).))))))))..))))(((((....(((((((.(((..(((((((((((((..(((..(.((...((((((.((.((......)).))))))))..)).)..)))..))))))...)))))))))).((((((...((((((((((.(((.((..(((((((.((....))))).).)))..))..))).))))))))))......((.....)).))))))...((((((..((((((....))))))....))))))(((((((.((((...((((((((....((.(((.((((((((((((((..........)))).....)))).))..)))).)))))....))))))))..))))..........(((.....(((((....))))))))...........)))))))((((....))))....)))))))..))))).........)))))).......))))))).)))))...((((....)))).(((((((((.((((..(((((.....))))).))))...((((((((.(((((((((.(((.(((.(......).))).))).))))).)))).(((......((((((...(((....((((((((((((((((((((((...........)))))).((((((((((((..((((..((((((.........))))))...))))((((((.(((((........((((((((....))))))))..)))))....)))))).........((((((.......(((((((....))))).))......)))))))))))))))))).........((((.........))))..)))))))))).))))))...)))))))))...((((...)))).....(((((..(((....)))..)))))))).))))).)))))))).))))..((((((((((((..(((...((((((((((...((((.......))))..)))))))))).(((((((((((((.....((((((((.((.((((((....((.....))..)))))))))))))))).....)))))(((((.(((.(((.(((((((..(((((((.........))))))).))))))))))))).((((((((((((((......))))..))))))))))((.(((.....))).))...(((((((((((......)))))....))))))(((((.(((((((..(((..(((.....((((((((((((((((((((....))))))))))))))))))))....)))..))))))))))..)))))..((........((((((((..(((((((((....(((.....(((......((((....(((...)))))))......)))....)))....))))))))))))))))).........))..((((((......))))))(((((((.((....)).)))))))(((...(((((.((....)).))))).))))))))((((((.....)))))).((((.....(((((((((((((((((((.((......(((((((((....((......))....)))))))))......))...))))))))).......((((.((((((((...)))))))))))).))))))))))..))))..))))))))...))))))))))).))))........))))................
Thermodynamic Ensemble Prediction
,((({{{,,((((((......|.)})))}.,.||{.((((((((((((.....((((((..(((,,,.|||..(((((..((({.,(((..(((((...((((.((...((((.........))))}})))).((((((..(({..{((.(((({(({{..(((((((.((((..((((((.(((((.(((((((..(((((((.{(,(((..,.,{(({{.,}))}}))).}),..))))))).......((((.((((((,.(((((,...,))))).}..)))))).)))).((((((((.{......}.)))))))).)))))))..)))))))).)))...)))).))).)))),)||((,||||}||{{.,{|||....))))}|))).)})).)})..},)))))){.(((.((((...))))...))),.....))))).}}},))))...)))))..,{{|.....,,(((.(((((((((((..((.(((((.....))))).))..))),.})))))))))).}|||(({{(((((((((..(((((((((({((({,((((((.((((((((.((((((({((((((((......))))))).(((..((((((({(((((..(((..(.((...((((((.((.((......)).))))))))..)).)..)))..)))))}...)))))))))).,,..,....((((((((((.(((.((..(((((((.((....))))).).)))..))..))).)))))))))).......)).})))))).)))))).{{,{.{.((((((.((((((((({.....,.})))))))))..)))))),.||||..,,...,.....||||,,|||,||||.,....}}}},))})).))))))))))...,.)))))..}))))..))))))).)}.,........(((.....(((((....))))))))....,}}}|{(((.......}}})),}}||{{..{|{(,..}}))..}},,.,....)))))).......))))))).))))).,.,|||,..{((((.(((((((((.((((..(((((.....))))).))))...((((((((.(((((((((.(((.{{{,(,,....),))).))).))))).)))).(((,...,.((((((...(((.,..((((((((((((((({((((((...........)))))).((((((((((((..((((..((((((.........))))))...)))){{{{((,{{{({........{(((((({....}))))))},,|,|||{{,.}}}))),,,.,,,..((((((......,(((((({....})))).)),,....)))))))))))))))))).........((((.........))))..})))))))))},)))))...))))))))),..{{((,..||}|,.,|.,((((..{{|....)))..)))))))).))))).)))))))).))))..))))|{{{{|||,.||,.,.((((((((((...(((.......,}}.,..)))))))))),{{.{{{{((({{({(...,,,(((((.((.((((((..,,({.....)}..)))))))))))))|||{.{{.,,,,,..}}}}}|.((((.(((((((..(((((((.........))))))).))))))))))),..,((((((((({{{({.....))))..)))))))))}||},||}}}},,))}}},..(((((((((((,....,)))))....)))))),{{{{.{{{{{{{{{{{{..{{{,,.,.((((((((((((((((((({....)))))))))))))}))))))....}}}..,}}}}}}})),})})))}},,.,,,,,..,,{{{(((..(((((((((....(((.....(((......((((,..,,{{...)})))))......)))....)))....)))))))))))))}})),,,...,{{{{{|{.,||,((({{{{{({,,(((.(((((..(((((((.{{({,,.(((((,((({(({{{{{|,||,,.,}}},))}}}{((((((((.((((({,((({(((((((.((((((((((.........)))))))))}..}))).}.,,,,,,,..}}}.}}})}}))))),))))))))},...}))))),.))))),.}}))))))))).))))).))),})))}})}))}|{(((((.....))))))}...|||||}||||,.,,,),,,.....)))),.....,,,,,,,,..

Transcripts

ID Sequence Length GC content
ACACAACAACUCUUCCCCGCUGAGAGGAGACAGCCAGUGCGACUCCACC… 2338 nt 0.5145
Summary

The protein encoded by this gene is a mitogen that is secreted by vascular endothelial cells. The encoded protein plays a role in chondrocyte proliferation and differentiation, cell adhesion in many cell types, and is related to platelet-derived growth factor. Certain polymorphisms in this gene have been linked with a higher incidence of systemic sclerosis. [provided by RefSeq, Nov 2009] CIViC Summary for CCN2 Gene

Forensic Context

A study in human and rat corpus cavernosum identified the CCN2 as a secreted protein positively correlated with all three fibroblast niche scores derived from spatial transcriptomic analysis [Yin et al. DOI:10.1016/j.celrep.2024.114760]. A study in rats demonstrated that the CCN2 mRNA and protein are significantly upregulated specifically in the iliopsoas muscle during severe, fatal hypothermia, identifying it as a potential diagnostic marker for this condition [Umehara et al. DOI:10.1007/s00414-018-1888-3]. Separately, research in mice showed that the CCN2 mRNA is significantly upregulated in lung tissue following hyperoxia exposure, indicating a serious risk for developing fibrosing alveolitis [Shimada et al. DOI:10.1007/S00414-008-0226-6].