| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACACAACAACUCUUCCCCGCUGAGAGGAGACAGCCAGUGCGACUCCACC… | 2338 nt | 0.5145 |
The protein encoded by this gene is a mitogen that is secreted by vascular endothelial cells. The encoded protein plays a role in chondrocyte proliferation and differentiation, cell adhesion in many cell types, and is related to platelet-derived growth factor. Certain polymorphisms in this gene have been linked with a higher incidence of systemic sclerosis. [provided by RefSeq, Nov 2009] CIViC Summary for CCN2 Gene
A study in human and rat corpus cavernosum identified the CCN2 as a secreted protein positively correlated with all three fibroblast niche scores derived from spatial transcriptomic analysis [Yin et al. DOI:10.1016/j.celrep.2024.114760]. A study in rats demonstrated that the CCN2 mRNA and protein are significantly upregulated specifically in the iliopsoas muscle during severe, fatal hypothermia, identifying it as a potential diagnostic marker for this condition [Umehara et al. DOI:10.1007/s00414-018-1888-3]. Separately, research in mice showed that the CCN2 mRNA is significantly upregulated in lung tissue following hyperoxia exposure, indicating a serious risk for developing fibrosing alveolitis [Shimada et al. DOI:10.1007/S00414-008-0226-6].