| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAAGAUCCCCAGCGCUGCGGGCUCGGAGAGCAGUCCUAACGGCGCCUCG… | 1488 nt | 0.4516 |
Cyclin B2 is a member of the cyclin family, specifically the B-type cyclins. The B-type cyclins, B1 and B2, associate with p34cdc2 and are essential components of the cell cycle regulatory machinery. B1 and B2 differ in their subcellular localization. Cyclin B1 co-localizes with microtubules, whereas cyclin B2 is primarily associated with the Golgi region. Cyclin B2 also binds to transforming growth factor beta RII and thus cyclin B2/cdc2 may play a key role in transforming growth factor beta-mediated cell cycle control. [provided by RefSeq, Jul 2008]
A study in humans identified the CCNB2 as a hub gene and diagnostic biomarker, showing it was significantly upregulated in burn injury tissues with an area under the curve greater than 0.68, indicating promising diagnostic value [Zhou et al. DOI:10.3389/fgene.2022.829841]. In porcine skin exposed to bromine vapor, the CCNB2 was significantly increased, with fold changes of 8.68 and 6.82 at 10- and 20-minute exposures, respectively, identifying it as a component of altered signaling pathways [Rogers et al. DOI:10.1002/jbt.20383]. In a mouse model of traumatic brain injury, the CCNB2 gene was found to be upregulated in the striatum at 2 days post-injury, indicating its involvement in the early transcriptional response to focal brain trauma [Kounelis-Wuillaume et al. DOI:10.1177/08977151251390528].