| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACACCAGCCCUCAGUCACUGGGAGAAGAACCUCUCAUACCCUCGGUGCU… | 1372 nt | 0.5241 | |
| ACACCAGCCCUCAGUCACUGGGAGAAGAACCUCUCAUACCCUCGGUGCU… | 1501 nt | 0.5243 |
Actins are highly conserved proteins that are involved in various types of cell motility and in the maintenance of the cytoskeleton. Three types of actins, alpha, beta and gamma, have been identified in vertebrates. Alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. The beta and gamma actins co-exist in most cell types as components of the cytoskeleton and as mediators of internal cell motility. This gene encodes actin gamma 2; a smooth muscle actin found in enteric tissues. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Based on similarity to peptide cleavage of related actins, the mature protein of this gene is formed by removal of two N-terminal peptides.[provided by RefSeq, Dec 2010]
A study in human corpus cavernosum tissue identified the ACTG2 as a gene marker characterizing the EC4 subcluster, which is associated with endothelial-mesenchymal transition and is upregulated in this subcluster [Zhao et al. DOI:10.1038/s41467-022-31950-9]. In rat cardiac fibroblasts, RNA sequencing revealed the ACTG2 is downregulated in adult cells compared to younger groups, indicating its role as a cardiac development-associated gene whose expression decreases with developmental age [Perreault et al. DOI:10.1152/physiolgenomics.00074.2021].