Basic Information

Symbol
CCR1
RNA class
mRNA
Alias
C-C Motif Chemokine Receptor 1 MIP1aR CMKBR1 SCYAR1 CKR-1 CD191 Macrophage Inflammatory Protein 1-Alpha Receptor Chemokine (C-C Motif) Receptor 1 C-C Chemokine Receptor Type 1 LD78 Receptor MIP-1alpha-R C-C CKR-1 CC-CKR-1 RANTES-R HM145 CCR-1 RANTES Receptor CD191 Antigen CMKR1 CKR1
Location (GRCh38)
3:46201711-46208378
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Cause of death analysis Mechanical injury analysis Wound age identification
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_001295.3
Sequence length
2646.0 nt
GC content
0.4630

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-804.10 kcal/mol
Thermodynamic ensemble
Free energy: -853.34 kcal/mol
Frequency: 0.0000
Diversity: 744.23
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....((((((((...))))..((((((.((.(((..(((((((((.....((((...((((....((.((((((((..((((..((((...((...((((..(((..((((((((....)))..))).))((((((...))))))...)))...))))...))))))..))))...))))).)))))))))))))..)))))))))(((((((((.((((((...))))))((((((......(((.((((..((........))..)))).))).(((.((((..(((((((((..((((((.((((((...((((((...))))))(((((((..(((.(((((.(((((((.((((((((((((.....)))))...))))))))))..)).)).))))).))).....)))))))((((((((............((((((..(((((..((((((((((...))))))))))..........((((((....))))))..........)))))..)))))).((((((......))))))..........(((((((..((.(.((((((((((((.(((.((((((((.(((((((((...............))))))))).)))(((((((...)))))))........((((((.((.....((((((..(((((((((((.((((.....))))))))))......((((((.......(((((.((((((((......((.((..(((.((((....))))..)))..)).)))))))))).)))))...........................(((........)))....((((((((........))))))))))))))....((((.(((((...((...((((..(((((..((((.((((((((((((((((....((.(.(((((.((((......))))..))))).)))....))..))))))))..........))))))))).)..))))).))))....)).......(((((((((......)).)))))))))))).)))).....((((....))))(((((.((((((......)))))))).))).)))))..)))))))).))))))....))))).)))..((((((((......(((((((....)))))))((((((...((((.(((((((..((...))..))))))).))))..))))))..((((((.......((((.((.((((((((((.((....)).)))))))))).))...))))...)))))).)))))))).....(((((((.((((((((................((((.((.....)).))))(((((((((((....))))).........((((((((((...........))).)).))))).(((((.(((((((((((.....................))))))))).))..)))))...........(((.(((....))))))(((((....(((((...(((((((....)))))))))))).))))).......((((((((((...((((.....((((((((((....))))))).)))(((((......)))))..(((((((...(((.((((((((.(.((((((((((((((((.((.((((((((.(.....).)))))))).)).......(((((.........)))))....((((.(........)...))))...((((((....))))))..(((((......)))))...(((((......................))))).)))))))((((((((((..(((((.........))))))))))........)))))...))))))))).)..............((((((..(((((((((.......))))))..............)))..)))))).))))))))..)))....)))))))...................))))...)))....))).))))...)))))))))))))))))))))(((((....)))))..)))))..))))))).).))...))))))).))))))))...........................(((((.((((...(((((.((.....))))))).)))).))))))))))).))))))..)).)))))))..)))).))).......((((..((((.((((.....))))))))..))))..))))))...((((((........))))))...........))).))))))......((((((((....(((.(((.........(((........)))(((.((((((((((.........)))).)))))).)))(((((.....(((((.(((((((((((.((((.....((((......(((......................)))......))))...)))).).)).)))))))).))))).....)))))))).)))....))))))))..(((((((......)).))))).))).))))))))((((((.(.......).))))))...))))((((((....))))))..................
Thermodynamic Ensemble Prediction
.....({{{((((...))))..{(((({{((.(((..(((((((((.....((((...(((,...{((.({((((((..((((..((((...({...((((..(((.{((((((((....)))..))),),((((((...))))))...)))..})))}...)}))))..))))...)))))},)}))))))))))..)))))))))(((({((((,((((((...}))))){{{{{{......(((.((((..((........))..)))).))}.{((.((((,{(((((((((..((((((.((((((,..((((((...)))))){((((((.,(((,(((((.(({,(((.((((((((((((.....)))))}..,)))))))))..,}.)).))))).)),...,,))))))}((((((((.....,{,....{(((((..(((((,{((((((((((...))))))))))..,},.....,(((((....)))))}..........}))))..)))))}.((((((......))))))..........{((((({..((.{.((((((((((({.(((.((((((((.(((((((((.........,.....))))))))).)))({(((((...}))))}).,,..,..{{{(((.{(|....{(((((..((((({(((((,((((,....|||||}}}}}..,,..((({{{.,,....(((((.((((((({.....{((.((..(((.((((....))))..)))..)).)))))))))).)))))..............,............{{{,,......})}....((((((((.,....}.)))))))))))))),||||||{||||{{,}}||},}||{{.,(((((..{({(.(((((((((((((({|..,{{{.{.{|(((.((((......)))),,)}}}},,}}..},}}.,)))))))),,....,,,.))))))))),),.))))),))}}...,||{{{{{,.{{{{{{{{{||,..,|,,))}}|}}}}}}}.,}}.,.,||{{{|....}))))))},.((((((......))))))|}|,}}})))))..))))))}}.))))},....))))).))}.,{{{{((((......(((((((...,}))))}}{{{{||,,,|||{.(((((((..((...))..))))))),|}||,,||||||..(((((({,.....{{((,((,{{(((({{{(.({,,,,|}.}})))))))),||...|}}},..}|||}}.}})))}}).....{{{((({.((({{{,........{{((({...})))}},....,}}.}}}|{||||{(((((,,..|}}}}..,...,,.{{{{{{||{({({{{{.,{{{|||{{||,,|||{(((((,({(((((((((..,..................))))))))).)},,}}|||{{,,,,,....}}))))})).,)),}..(((((....(((((...(((((((....)))))))))))).))))).,,,|,.|||,||,,((((((,((.....((((((((((....))))))).))){{{{{..,{{{|}}}}.}}}|}.....,,,,.(((((((...,..((((({{{.,{,...((.((((((((.(,...,).)))))))).))....{{{..((({..{{....,.))))))..}}}..........)},..))))).,,,.)))))))((((((.,(((({{..,,|,,,)}..,..}}))}}..)))))).............,..)),)))))),.{(((((..(((((.{.....,.))))))))))|,,.{{{{{{{.{{..{(((((((((..................)))))))}}|,||.}}}}}}},,)))},,,}}}}}..,,,,))),,))}))}}.)))))))}}}}.}||||}|{{,,.,{{,,,,.,,,,......,||||{{|{{{{,.{||...,..,))))))))))))))}}}}}}}}{((((....))))}..)))))..))))))).).))...))))))).))))))))...........................,((((.((((...(((({{(({...,))))))).)))).))))})))))).})))))..)).})))))),.))}}.))}..,,,..((((.,((((.((((.....)))))))).,))))..)))}}}...{(((((........)))))).,.....,,..})),,)))))...,,.{{{{((((....(({.{{{.........{{{.,......},},{{.{{{{{,.,,,..,,,,,,.,|||.}}}}},.}}}{{{{{.....(((((.((((((((,,..,{,{,,{,.{,,.....{((((,..,,{........,.,.....))}......)))))..}}))})})),)))))))).))))),,,,,)))))))).}}}....)))))})),,{((((((......)),,)))).))).}))))))}{(((((,{.......),)))))},..)))}((((({....})))))..................

Transcripts

ID Sequence Length GC content
NM_001295.3 NCBI
AGACUUCACGGACAAAGUCCCUUGGAACCAGAGAGAAGCCGGGAUGGAA… 2646 nt 0.4630
Summary

This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. The ligands of this receptor include macrophage inflammatory protein 1 alpha (MIP-1 alpha), regulated on activation normal T expressed and secreted protein (RANTES), monocyte chemoattractant protein 3 (MCP-3), and myeloid progenitor inhibitory factor-1 (MPIF-1). Chemokines and their receptors mediated signal transduction are critical for the recruitment of effector immune cells to the site of inflammation. Knockout studies of the mouse homolog suggested the roles of this gene in host protection from inflammatory response, and susceptibility to virus and parasite. This gene and other chemokine receptor genes, including CCR2, CCRL2, CCR3, CCR5 and CCXCR1, are found to form a gene cluster on chromosome 3p. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the CCR1 was down-regulated in sepsis non-survivors compared to survivors, binds to CCL3 and CCL5 ligands to participate in the CCL signaling pathway, and was significantly correlated with monocytes [Liu et al. DOI:10.1590/1414-431X2025e14930]. An investigation in porcine skin showed that the CCR1 transcript was significantly increased at 6 hours, 48 hours, and 7 days following cutaneous bromine vapor exposure and was involved in significantly altered signaling pathways including IL-10 and IL-17 [Price et al. DOI:10.3109/15569527.2010.546003]. A study in porcine skin exposed to bromine vapor demonstrated that the CCR1 was significantly upregulated, showing a 18.7-fold increase after a 10-minute exposure and a 12.0-fold increase after a 20-minute exposure, identifying it as a component of significantly altered signaling pathways [Rogers et al. DOI:10.1002/jbt.20383]. In a separate investigation using a mouse model of local hind limb burn injury, the CCR1 was found to be upregulated specifically at the 3-day post-burn time point, indicating a distinct, injury-specific transcriptional response in skeletal muscle [Padfield et al. DOI:10.01.ta.0000230567.56797.6c].